ID: 969862218

View in Genome Browser
Species Human (GRCh38)
Location 4:10046523-10046545
Sequence TAATCCCCACACATAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3665
Summary {0: 1, 1: 4, 2: 63, 3: 669, 4: 2928}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969862218_969862224 3 Left 969862218 4:10046523-10046545 CCTCCCACTATGTGTGGGGATTA 0: 1
1: 4
2: 63
3: 669
4: 2928
Right 969862224 4:10046549-10046571 TTCAAGATGAGATGTAGGTGGGG 0: 6
1: 421
2: 8633
3: 11705
4: 9744
969862218_969862225 29 Left 969862218 4:10046523-10046545 CCTCCCACTATGTGTGGGGATTA 0: 1
1: 4
2: 63
3: 669
4: 2928
Right 969862225 4:10046575-10046597 CAGAGCCAAATCATATCACATGG 0: 2
1: 55
2: 390
3: 1106
4: 1705
969862218_969862222 1 Left 969862218 4:10046523-10046545 CCTCCCACTATGTGTGGGGATTA 0: 1
1: 4
2: 63
3: 669
4: 2928
Right 969862222 4:10046547-10046569 AATTCAAGATGAGATGTAGGTGG 0: 6
1: 444
2: 8721
3: 11716
4: 9858
969862218_969862221 -2 Left 969862218 4:10046523-10046545 CCTCCCACTATGTGTGGGGATTA 0: 1
1: 4
2: 63
3: 669
4: 2928
Right 969862221 4:10046544-10046566 TACAATTCAAGATGAGATGTAGG 0: 94
1: 7194
2: 10578
3: 9493
4: 7837
969862218_969862223 2 Left 969862218 4:10046523-10046545 CCTCCCACTATGTGTGGGGATTA 0: 1
1: 4
2: 63
3: 669
4: 2928
Right 969862223 4:10046548-10046570 ATTCAAGATGAGATGTAGGTGGG 0: 7
1: 415
2: 8656
3: 11701
4: 10264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969862218 Original CRISPR TAATCCCCACACATAGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr