ID: 969863340

View in Genome Browser
Species Human (GRCh38)
Location 4:10055049-10055071
Sequence CAGGAACCTTTTTGATGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969863340_969863343 -9 Left 969863340 4:10055049-10055071 CCAGTTCATCAAAAAGGTTCCTG No data
Right 969863343 4:10055063-10055085 AGGTTCCTGTTGGCCAGGCACGG No data
969863340_969863349 25 Left 969863340 4:10055049-10055071 CCAGTTCATCAAAAAGGTTCCTG No data
Right 969863349 4:10055097-10055119 TGTAACCCCAGCACTTTGGGAGG 0: 4078
1: 294830
2: 265780
3: 152940
4: 134736
969863340_969863346 21 Left 969863340 4:10055049-10055071 CCAGTTCATCAAAAAGGTTCCTG No data
Right 969863346 4:10055093-10055115 TACCTGTAACCCCAGCACTTTGG 0: 108
1: 7608
2: 172892
3: 308668
4: 210857
969863340_969863347 22 Left 969863340 4:10055049-10055071 CCAGTTCATCAAAAAGGTTCCTG No data
Right 969863347 4:10055094-10055116 ACCTGTAACCCCAGCACTTTGGG 0: 1226
1: 77023
2: 304902
3: 244995
4: 149824

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969863340 Original CRISPR CAGGAACCTTTTTGATGAAC TGG (reversed) Intergenic
No off target data available for this crispr