ID: 969863425

View in Genome Browser
Species Human (GRCh38)
Location 4:10055575-10055597
Sequence CAGGATATTCAACCTTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969863425_969863428 7 Left 969863425 4:10055575-10055597 CCCTGGCAAGGTTGAATATCCTG No data
Right 969863428 4:10055605-10055627 GTGACACTCATTGTCTGCTCAGG 0: 1
1: 0
2: 1
3: 6
4: 102
969863425_969863430 30 Left 969863425 4:10055575-10055597 CCCTGGCAAGGTTGAATATCCTG No data
Right 969863430 4:10055628-10055650 GTTTTCAAAACAAGCCAGAGTGG No data
969863425_969863429 8 Left 969863425 4:10055575-10055597 CCCTGGCAAGGTTGAATATCCTG No data
Right 969863429 4:10055606-10055628 TGACACTCATTGTCTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969863425 Original CRISPR CAGGATATTCAACCTTGCCA GGG (reversed) Intergenic
No off target data available for this crispr