ID: 969869824

View in Genome Browser
Species Human (GRCh38)
Location 4:10097574-10097596
Sequence TACACAGAAGTGGGCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969869824_969869829 -8 Left 969869824 4:10097574-10097596 CCCTGGGAGCCCACTTCTGTGTA 0: 1
1: 0
2: 2
3: 14
4: 162
Right 969869829 4:10097589-10097611 TCTGTGTATCATGGCATACGTGG 0: 1
1: 0
2: 0
3: 4
4: 62
969869824_969869830 4 Left 969869824 4:10097574-10097596 CCCTGGGAGCCCACTTCTGTGTA 0: 1
1: 0
2: 2
3: 14
4: 162
Right 969869830 4:10097601-10097623 GGCATACGTGGCATGTGCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 101
969869824_969869831 29 Left 969869824 4:10097574-10097596 CCCTGGGAGCCCACTTCTGTGTA 0: 1
1: 0
2: 2
3: 14
4: 162
Right 969869831 4:10097626-10097648 TCTGCCATCAGCATCTAAACAGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969869824 Original CRISPR TACACAGAAGTGGGCTCCCA GGG (reversed) Intronic