ID: 969870782

View in Genome Browser
Species Human (GRCh38)
Location 4:10103378-10103400
Sequence CAGAAATGCCACCATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969870782_969870784 -7 Left 969870782 4:10103378-10103400 CCAACCTCATGGTGGCATTTCTG 0: 1
1: 0
2: 1
3: 18
4: 255
Right 969870784 4:10103394-10103416 ATTTCTGCTGACCTCCAAGCTGG 0: 1
1: 0
2: 3
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969870782 Original CRISPR CAGAAATGCCACCATGAGGT TGG (reversed) Intronic
900353292 1:2247590-2247612 TAGAAATGCCTCCCTGGGGTTGG + Intronic
901517702 1:9760425-9760447 CACAAATGGCCCCTTGAGGTAGG - Intronic
902178589 1:14670252-14670274 CACAAATGCCTTCAGGAGGTGGG - Intronic
902550422 1:17215934-17215956 CACAAATGACACCATGAGTCTGG - Intronic
903432435 1:23317160-23317182 CAGAAATGCAACTCTGAGGCCGG + Intronic
904326985 1:29732944-29732966 CAGAAATGCCTCTTAGAGGTTGG - Intergenic
905623800 1:39473252-39473274 CCCAGAGGCCACCATGAGGTAGG - Intronic
906620158 1:47270330-47270352 CAGAAATGCCAGGAAGAGGTAGG + Intronic
908394536 1:63713431-63713453 CAGAAGTGGCAAGATGAGGTTGG + Intergenic
910806882 1:91197253-91197275 CATAAATTCCACCAAGAGGAAGG - Intergenic
911229880 1:95349665-95349687 CAGTAATGCCACCATGGTGTGGG + Intergenic
915052584 1:153091495-153091517 CATAACTGCCACCCTGTGGTAGG - Intergenic
916408241 1:164518887-164518909 CCCATCTGCCACCATGAGGTTGG - Intergenic
916506984 1:165436878-165436900 CTGAAATCCCACCAGGAGTTTGG - Intronic
917655123 1:177118592-177118614 AAGAAATCCCACCATTAGTTTGG - Intronic
917819449 1:178747554-178747576 CAGAAATGGCAGCATGTGTTAGG + Intronic
919081242 1:192868722-192868744 TAGAAATGCCAACATTTGGTGGG - Intergenic
920227556 1:204449524-204449546 CAGGGATGCCTTCATGAGGTGGG + Intronic
920363944 1:205438325-205438347 CAGAGACTCCACCTTGAGGTGGG - Intronic
923473952 1:234315763-234315785 CAGAAATGTCACCAGGTGGGAGG - Intronic
1063599815 10:7470206-7470228 CAGAATTGCCATCCTGAGCTGGG + Intergenic
1064321001 10:14304611-14304633 CAGAGAAGTCACCATGAGCTTGG - Intronic
1064996330 10:21299831-21299853 CAGGAAGGCAACCTTGAGGTGGG + Intergenic
1065094473 10:22267075-22267097 CAGAAATGCATCCATGGAGTAGG + Intergenic
1065631902 10:27689194-27689216 CAGAAATGACACAATGAGAGAGG + Intronic
1067552597 10:47246151-47246173 CTGAAATGCCACCATTTGGGAGG - Intergenic
1067657842 10:48210788-48210810 CAGAACAGCCAACATGAGGTTGG - Intronic
1067661774 10:48241441-48241463 CAGGAATGGCACCATGGAGTTGG - Intronic
1068539837 10:58279833-58279855 AAGAAATTACACCATGAGGCTGG + Intronic
1068742692 10:60492409-60492431 CAGAAATGGCACCGTGGGGCTGG + Intronic
1071756878 10:88552107-88552129 CCCAAATGCCCTCATGAGGTAGG + Intronic
1073400881 10:103256556-103256578 CATAAATGCAACCAAAAGGTTGG - Intergenic
1073550618 10:104397577-104397599 CAGAAATGACACCAAGATGATGG - Intronic
1073700629 10:105922898-105922920 CAGAAATGCTCCCATCAGGGGGG + Intergenic
1073848211 10:107583814-107583836 GAGCAATGCCACCATTAGGCTGG - Intergenic
1074885970 10:117693910-117693932 CAGAATTCCCAGGATGAGGTGGG - Intergenic
1076065304 10:127443608-127443630 GAGCAATGCCGCCATTAGGTAGG - Intronic
1076461215 10:130648891-130648913 CAGAGATGTCACCAGGAGGAGGG - Intergenic
1077704972 11:4476023-4476045 CAGCAAAGTCACCATGAGGCCGG - Intergenic
1080746553 11:35113120-35113142 CGGAAATGCCACCATTAGTAAGG + Intergenic
1080783264 11:35450506-35450528 CAGAAATGCCTCCATGATGTGGG + Intronic
1080933755 11:36840188-36840210 CAGAATTGACACCATGATGATGG + Intergenic
1080999267 11:37647747-37647769 CAGAAATGCCATGAAGTGGTTGG - Intergenic
1081634128 11:44709469-44709491 TAAACATGCCCCCATGAGGTGGG - Intergenic
1084441924 11:69179471-69179493 CAGAGATGGCTCCAAGAGGTGGG - Intergenic
1085732594 11:79012196-79012218 CAGAAAAGTCACCATGAGAGTGG + Intronic
1090907602 11:131090801-131090823 CAGGTATGCCACTTTGAGGTTGG - Intergenic
1091095203 11:132814488-132814510 CAGAAATGAAAACATGAGGAAGG + Intronic
1091413216 12:257841-257863 CAGGAATGGCACGAAGAGGTGGG - Intronic
1092762976 12:11826219-11826241 CAAAAATGCTCCCCTGAGGTTGG - Intronic
1093804592 12:23416624-23416646 TTGAAAAGCCACCATGAGATAGG - Intergenic
1096212380 12:49776518-49776540 CTGAACTGCCACCCTGTGGTGGG - Intergenic
1096478451 12:51922834-51922856 GAAAAGTGCCACCATGAGGATGG - Intronic
1098598770 12:72304331-72304353 AGGAAATACCACCATAAGGTGGG + Intronic
1099122403 12:78707714-78707736 CAGAAATGCCAGTAGGAGATGGG + Intergenic
1101315050 12:103621435-103621457 CAGAAATGCAAAACTGAGGTTGG + Intronic
1101564215 12:105890381-105890403 CTGAATTGTCACCTTGAGGTGGG - Intergenic
1101732285 12:107436713-107436735 CAGAAGTCCCACCATGCGCTGGG - Intronic
1102401096 12:112630461-112630483 CATAAATTCCACCATGGAGTTGG + Intronic
1102638777 12:114347780-114347802 AAGACAAGCCACCATGAGCTGGG + Intergenic
1103434521 12:120914630-120914652 CAGAAATTCCACCATCTTGTTGG - Intergenic
1104045624 12:125160522-125160544 CAGAAATGCCAAGCTGAGGAAGG + Intergenic
1106277435 13:28225540-28225562 CAGAAATGCCACCTCTAGATTGG - Intronic
1107525454 13:41226848-41226870 CAGAAATGCCCGGATGAGCTAGG - Intronic
1108937006 13:55894134-55894156 CATAAATGCCAAGATGATGTTGG + Intergenic
1108977887 13:56472221-56472243 CTGTAATCCCAGCATGAGGTGGG + Intergenic
1109044134 13:57386325-57386347 GAGGAATGCTACCATGAGATAGG - Intergenic
1109990026 13:70042090-70042112 TAGAAATGCCAACAAGAAGTGGG - Intronic
1110810505 13:79807033-79807055 CAGAATGGCCACCAGGAGGGAGG + Intergenic
1111357597 13:87129063-87129085 CAGAAATGACAACAAGAAGTTGG - Intergenic
1112704903 13:102056550-102056572 CACAAATGAGACCATGAAGTAGG - Intronic
1113670407 13:112171899-112171921 CAGAAATGGCACAATGAGACGGG + Intergenic
1114894351 14:26968349-26968371 CAGAAATGTCATTTTGAGGTAGG + Intergenic
1117464031 14:55974592-55974614 TAGAAATGCCACCCTGAGAAAGG + Intergenic
1120157682 14:81112076-81112098 CTGGAATGCCACCAAGAGGCAGG - Intronic
1121644613 14:95509291-95509313 GAGAAAGGCCACGATGAGCTAGG + Intergenic
1125588139 15:40836693-40836715 CAGAAATGCTCACATGAGGGTGG - Intergenic
1125602718 15:40924299-40924321 CTGAACTGCCACCATGAAGGAGG + Intergenic
1129878954 15:78994685-78994707 CTGGAATGCCACTATGAGCTTGG + Intronic
1131365407 15:91834843-91834865 CAGAAATGCAAGCAGGATGTGGG + Intergenic
1133638386 16:7692559-7692581 TAAAAATGGCACAATGAGGTTGG - Intronic
1133722313 16:8506592-8506614 CAGGAGTGACACCCTGAGGTTGG + Intergenic
1133873224 16:9709073-9709095 CAGAAATTCCACTATGAGAAAGG - Intergenic
1134439870 16:14293027-14293049 CAGAAATGCCGCCGTGACTTGGG - Intergenic
1135411555 16:22238825-22238847 CAGTAATGTTACCATCAGGTGGG - Intronic
1135959968 16:26987237-26987259 GAGAAAGGCAACTATGAGGTTGG - Intergenic
1136632939 16:31499679-31499701 CTAAAATGCCACCATTAGCTGGG + Intronic
1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG + Intergenic
1140224150 16:73065307-73065329 AAGAAATGCAAGCATGGGGTGGG - Intergenic
1140653740 16:77117928-77117950 CAGAAGTGCAGGCATGAGGTTGG - Intergenic
1143951843 17:10638745-10638767 CAGAAAGGGAACCATGAGGCAGG + Intronic
1146412450 17:32598443-32598465 CAAAAATTCCACCATGGGGTGGG - Intronic
1148254741 17:46119963-46119985 CAGAAATGGATCCAAGAGGTAGG - Intronic
1149466615 17:56884756-56884778 CAGACAGGCCAGCATCAGGTGGG + Intergenic
1151462077 17:74260424-74260446 CAGAAATGCCCCCAGGTGCTTGG + Exonic
1152205607 17:78973007-78973029 CAGCAATGTCACCATGAGTGTGG - Exonic
1152840763 17:82566674-82566696 CACAGCTGCCACCCTGAGGTTGG + Intronic
1153990067 18:10388684-10388706 CAGAAATGGCCCCAGGAAGTGGG + Intergenic
1154071811 18:11159476-11159498 CATAAAAGCCATCATGAGGAAGG - Intergenic
1154260823 18:12831010-12831032 CAGAAATGGCAGCATGTGTTAGG + Exonic
1154306969 18:13237739-13237761 CAGCAATGCCTCCATGAAGGGGG - Intronic
1156065297 18:33136015-33136037 CAGAAAACTCACCATGAGGAAGG + Intronic
1156527439 18:37779651-37779673 CAGAAATGCTACAACGAGGGTGG + Intergenic
1157380479 18:47210716-47210738 CACAAATGCACCCGTGAGGTTGG - Intergenic
1159296319 18:66494077-66494099 TAGAAATTCCACCATGGAGTAGG + Intergenic
1161543335 19:4865614-4865636 AAGCAAGGCCACCAGGAGGTGGG - Intronic
1161675582 19:5646593-5646615 CAGAATTCCCAGCATGGGGTAGG + Intronic
1168421449 19:56206719-56206741 CAGAAATACCATCCTGAGGCAGG + Intronic
926424113 2:12725824-12725846 CACACATGCCACCATGCTGTAGG - Intronic
927028741 2:19098251-19098273 CAGCAAAGGCACCATCAGGTTGG - Intergenic
933214516 2:79613874-79613896 CAGTATTGGCACCATGAGATTGG - Intronic
935865527 2:107383801-107383823 CAGACATACAACCATCAGGTTGG - Intergenic
936891392 2:117373922-117373944 AAGAAAAACCACCATGAGGAGGG + Intergenic
937781403 2:125842952-125842974 CAGAAATGCCTACTTGAGATGGG + Intergenic
937896764 2:126982023-126982045 GAGAAATTCCACCATGAGTGGGG + Intergenic
940191785 2:151048344-151048366 CAGAAATGCCAGTAAGAGCTTGG + Intronic
941891672 2:170588637-170588659 GAGAAATGCCACTTTGATGTTGG - Intronic
942607339 2:177706649-177706671 CAAAAATGACTCCATAAGGTAGG + Intronic
942982465 2:182099078-182099100 GAGAAATTACACCATGGGGTGGG + Intronic
943562565 2:189481653-189481675 CAGAAACGCCACATTGAGCTGGG - Intergenic
943862728 2:192889476-192889498 CAGAAATTCCTCCATGAACTCGG + Intergenic
945480205 2:210336608-210336630 CAGAAATGCCAACAAGTTGTAGG + Intergenic
946317612 2:218928130-218928152 CTGAAAGGTCACCATGTGGTTGG + Intergenic
947294476 2:228615735-228615757 CAGAAATGACTCCTTGAAGTGGG - Intergenic
948131103 2:235601191-235601213 CAGAAACGCCACCTTGACCTTGG - Intronic
948619728 2:239226855-239226877 CTGAAATGCCACCCTGTGGCTGG - Intronic
948811242 2:240479503-240479525 CAGAAATGCCTGCATTAGGCTGG + Intronic
1169281810 20:4274203-4274225 CATAACTGACACCATGAGGCTGG + Intergenic
1169990529 20:11498148-11498170 CAGAAATACCAACATGATTTGGG - Intergenic
1170560893 20:17557404-17557426 CAGAGAAGCCCCCTTGAGGTAGG - Intronic
1171205008 20:23272356-23272378 CAGAAATGCAGCCATGCTGTGGG - Intergenic
1171465109 20:25322109-25322131 CGGAAATGCTACAGTGAGGTTGG + Intronic
1172371226 20:34393796-34393818 CAGACATACCACCAATAGGTTGG - Exonic
1173189829 20:40867747-40867769 CACAAATTCTACTATGAGGTGGG - Intergenic
1174364189 20:50046574-50046596 CTGACCTGCCACCAGGAGGTGGG + Intergenic
1175793765 20:61758482-61758504 CAGAATTGCCACGAGGAGTTAGG + Intronic
1177133040 21:17280133-17280155 CAGAGATGCCACCTTGGAGTTGG - Intergenic
1177510482 21:22080507-22080529 CAGAAAAGAAAACATGAGGTTGG + Intergenic
1177702182 21:24653713-24653735 CAGAAATGCCTGGATGAGATGGG - Intergenic
1178348661 21:31854131-31854153 TAGAAAGGGCACCATGAGGATGG + Intergenic
1178396101 21:32245234-32245256 CAGAAGTGACACCATCAGTTTGG - Intergenic
1180982012 22:19882967-19882989 TAGAAATGCCACCATGGCCTTGG - Intronic
1181603109 22:23963991-23964013 CAGAAAAGACAACATGAGCTGGG - Intergenic
1181605404 22:23977316-23977338 CAGAAAAGACAACATGAGCTGGG + Intronic
1183705598 22:39473463-39473485 CATAAATTCCTCCATGAGGGTGG + Intronic
1184057182 22:42060433-42060455 CACCAATGCCACCATGAGAGTGG + Intronic
1184405324 22:44297568-44297590 CAGAGCTACCACCGTGAGGTGGG - Intronic
949384467 3:3484956-3484978 CAGATATGCCACTAGGTGGTGGG - Intergenic
949467854 3:4362034-4362056 AAGAATTCCCACCCTGAGGTGGG - Exonic
949680990 3:6514184-6514206 CTGTAACACCACCATGAGGTTGG - Intergenic
950539923 3:13605870-13605892 GAGAAATGCCACACAGAGGTGGG - Intronic
952865971 3:37855375-37855397 CAGAAATGCCCTCAGGAGGCTGG - Intergenic
953505165 3:43478932-43478954 CAGAAATGCCTCCACAAGTTAGG + Intronic
954644837 3:52124884-52124906 CTGAGATGCAGCCATGAGGTCGG + Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955828028 3:62969590-62969612 TAAAAATGCCAACATGAAGTAGG - Intergenic
955944377 3:64178372-64178394 GAGATATGCCTCCATGAGGATGG + Intronic
956738491 3:72257077-72257099 CACATATGCCACTGTGAGGTAGG + Intergenic
957068566 3:75547014-75547036 CAGAAATGTCATCTGGAGGTAGG + Intergenic
959126347 3:102294461-102294483 AAGGAATGCCTCCCTGAGGTTGG + Intronic
959161378 3:102729134-102729156 CACAAATCCCATCATGAGGATGG - Intergenic
959586947 3:108033902-108033924 CAGACAGGCCACCAGGAGGTGGG - Intergenic
962128662 3:132649359-132649381 GAGAAAAGCCACCCTGTGGTGGG + Intronic
967493995 3:190122406-190122428 CAGAAATGCCTCCAGGAGGCAGG - Intronic
968846082 4:3042228-3042250 CGGGGATGTCACCATGAGGTTGG + Intergenic
969197171 4:5572339-5572361 CACAAATGCCACTATTAGGAAGG + Intronic
969841124 4:9882852-9882874 AATAAATACCATCATGAGGTTGG - Intronic
969870782 4:10103378-10103400 CAGAAATGCCACCATGAGGTTGG - Intronic
970717021 4:18938294-18938316 CTGAAATGCGACTATGAGCTGGG - Intergenic
971194261 4:24456955-24456977 CTGAACTGCCACCATCAGGGTGG - Intergenic
971509644 4:27408052-27408074 CAGAGATGACTCCAAGAGGTGGG - Intergenic
975357883 4:73429696-73429718 CATTAATGCAACCATGAGGGTGG - Intergenic
975650349 4:76586527-76586549 CAGAAATGCCAGCATTGGGAAGG + Intronic
978402807 4:108349013-108349035 CCCAAATGCCACCCTCAGGTAGG + Intergenic
982133928 4:152256195-152256217 GAGAAATGCCAGGATGAAGTAGG - Intergenic
982153131 4:152485638-152485660 CAGTAATGCATCCATGATGTTGG + Intronic
982651361 4:158091385-158091407 CACAAATGCACCCGTGAGGTGGG - Intergenic
983301778 4:165934723-165934745 CACAAAGGCCACCAGGAGATGGG - Intronic
986003983 5:3652237-3652259 CTGAAATGACTCCATGAGGGAGG + Intergenic
986742477 5:10716039-10716061 GAGCAATGCCAATATGAGGTGGG - Intronic
986958758 5:13188764-13188786 CAGAAAGCCCACCATGAGAATGG - Intergenic
989099126 5:37808407-37808429 GAGAAAGGCAGCCATGAGGTGGG - Intergenic
989683533 5:44058222-44058244 CTGCAATGCCAACCTGAGGTTGG - Intergenic
990001537 5:50899051-50899073 AAGAAATGCTGCCATGAGGAAGG + Intergenic
991569511 5:68039828-68039850 CATAAATGACACAAAGAGGTAGG - Intergenic
992470735 5:77050474-77050496 CAGAAATGCCACCAGAAGCCTGG - Intronic
992625711 5:78634299-78634321 CACCAATGCCACCGTGAGGGTGG + Intronic
992696510 5:79294105-79294127 TTAAAATGCCATCATGAGGTTGG + Intronic
993147823 5:84118638-84118660 CTGAAATGCTTCCATGAAGTAGG - Intronic
996647536 5:125834638-125834660 GAGAAATCCCACCATGTGGCTGG - Intergenic
1000944846 5:167408437-167408459 CAGAAATGCTATCAAGAAGTAGG - Intronic
1001416758 5:171550478-171550500 CAGAAATGCACACATGATGTAGG - Intergenic
1002040654 5:176511527-176511549 CAGAAATGAAAACATGAGGCCGG - Intergenic
1002126549 5:177049777-177049799 CAGAACTACCCCAATGAGGTAGG - Intronic
1002650918 5:180693015-180693037 CAGCAAGACCACCATCAGGTGGG + Intergenic
1003846829 6:10182480-10182502 CAGGAATGCCAGCATGTGGAAGG + Intronic
1004674175 6:17824998-17825020 CAGAAATGTCATCTTGTGGTTGG + Intronic
1006629621 6:35421776-35421798 AGGAAAGGCCACCAGGAGGTGGG - Intronic
1006711187 6:36072884-36072906 CAGATCTGCCCCCATGAGATGGG - Exonic
1007127878 6:39442512-39442534 CAGAAATGCCACCATGACCCAGG - Intronic
1007812064 6:44493381-44493403 CAGAGAAGCAACCATGAGGCAGG - Intergenic
1008548507 6:52604983-52605005 CAGAAGTGCCTTCATGAAGTGGG + Intergenic
1008764920 6:54900294-54900316 CTGATATGCCAGCATGGGGTAGG - Intronic
1009724676 6:67522854-67522876 GAGAAATGCCTGCATAAGGTAGG - Intergenic
1010190998 6:73196385-73196407 CAGAAACACCACCAGGAAGTTGG + Exonic
1011856837 6:91703534-91703556 CACAAATCTCACCATGAAGTTGG + Intergenic
1012396009 6:98797960-98797982 CAGGAATGCAACAATGAGGCAGG + Intergenic
1016782848 6:147979063-147979085 CAGAAATGCCACTTTGGAGTGGG + Intergenic
1018718202 6:166551841-166551863 CTGAAATGCAAACATGCGGTAGG + Intronic
1020156402 7:5728196-5728218 CAGAAGGGCCACCCTGAGGAAGG - Intronic
1020183458 7:5940644-5940666 CAAAAATGCTTCCATGAGGCTGG + Intronic
1020299452 7:6784114-6784136 CAAAAATGCTTCCATGAGGCTGG - Intronic
1020919228 7:14241013-14241035 CATAAATGCCAGCTAGAGGTTGG + Intronic
1023041968 7:36180293-36180315 CAGAAATGACACAATGGGATGGG - Intronic
1023586416 7:41735375-41735397 CGGAAGTTTCACCATGAGGTTGG + Intergenic
1023664335 7:42506112-42506134 CAGAAATATGACCATGAAGTTGG - Intergenic
1023741339 7:43283883-43283905 CAGAAATGACACGCTCAGGTAGG - Intronic
1024363438 7:48493649-48493671 ATGAAATGCCACCATGTGGGAGG + Intronic
1025006590 7:55360452-55360474 CAGACTTGCCTCCATGAGGCAGG + Intergenic
1025781266 7:64603846-64603868 AAGTAATGCCACCTTGAAGTTGG - Intergenic
1025912431 7:65839436-65839458 CGGAATGGCCACCATGAGGCAGG - Intergenic
1028430282 7:90738280-90738302 CTATAATACCACCATGAGGTTGG - Intronic
1028526917 7:91797174-91797196 CAGAAATGACCCCATCACGTAGG + Intronic
1031164309 7:118209777-118209799 CAGAAATGCAAACATGAAATAGG - Intergenic
1032444624 7:131971631-131971653 CAGAAATGCCTCCCCCAGGTTGG - Intergenic
1033287014 7:140049907-140049929 CTGGAATGCCAACGTGAGGTAGG - Intronic
1033681480 7:143600149-143600171 CAGAATCACCACCATGAGATAGG + Intergenic
1033703412 7:143861664-143861686 CAGAATCACCACCATGAGATAGG - Intronic
1034918677 7:155061168-155061190 CAGCAAGGACACCATGAGGTGGG - Intergenic
1035097102 7:156364665-156364687 CAGAAATGACACCAGGAAGATGG + Intergenic
1036173059 8:6508927-6508949 CACAAATGCTAACAGGAGGTAGG - Exonic
1037623125 8:20584485-20584507 CAGAGATGCCACCAGGGGTTGGG + Intergenic
1041828154 8:62121886-62121908 GAGAAATGTCACCATGATCTTGG + Intergenic
1042191875 8:66195210-66195232 CAGCAATACCTCTATGAGGTAGG - Intergenic
1042285391 8:67104491-67104513 CTGTAATCCCACCATGAGTTTGG - Intronic
1043812233 8:84754770-84754792 GATAGATGCCACCATGCGGTAGG + Intronic
1045227039 8:100258738-100258760 CAGAAATGCTACACTGATGTGGG + Exonic
1048680067 8:136831633-136831655 CCTAGATGCCACCATGAGGCTGG - Intergenic
1048891673 8:138953898-138953920 CAGAAATGCCAGCGTGAGGATGG - Intergenic
1049695651 8:143983222-143983244 CAGAAGTGCCACCAAGTGGCGGG + Exonic
1050106877 9:2174757-2174779 CAAAAATGCAAAAATGAGGTGGG + Intronic
1050949157 9:11566377-11566399 CAGAGATGCCATCAGGAGTTAGG + Intergenic
1051194444 9:14547662-14547684 CAGAAATGCATTCAGGAGGTGGG - Intergenic
1052990855 9:34518736-34518758 CAGCCATGACACCATGAGGGTGG + Intronic
1053292937 9:36894029-36894051 CAGAAAGACCTCCAGGAGGTTGG + Intronic
1056562925 9:87748412-87748434 CAGACATGACACCATGAAATAGG - Intergenic
1057719520 9:97520774-97520796 TAGAGATGCCACCCTGAGGGGGG - Intronic
1058391914 9:104504990-104505012 CAAAACTACCACCATCAGGTGGG - Exonic
1059751997 9:117256338-117256360 CAGAAATGCCACTCTGAGGGTGG + Intronic
1059860241 9:118452348-118452370 CAGAAATATCACCAAGAAGTGGG - Intergenic
1060709860 9:125849566-125849588 CAGAAATGCTAAAATGAGGAGGG - Intronic
1061144777 9:128791231-128791253 CAGGAATGCCAGCATGAGCTAGG - Intronic
1061777052 9:132972752-132972774 CAGGAGTGCCACCGTGTGGTGGG + Intronic
1185789671 X:2919327-2919349 CAGAGATCCCACCACCAGGTCGG + Intronic
1186331566 X:8540363-8540385 CAGAAATGCCACGATGCGCTTGG - Intronic
1187912520 X:24123892-24123914 CAGAAATGGCAGCAAGAGTTTGG + Intergenic
1190139695 X:47831978-47832000 CAGAGATGCCACCTAGTGGTGGG - Intergenic
1190888520 X:54549804-54549826 CAGACATGTCACTATGAGGCAGG + Intronic
1191136447 X:57070014-57070036 CAGAAATGGAAAAATGAGGTGGG - Intergenic
1195037058 X:100980217-100980239 TAGAAATGCCACCAGGAGCTAGG + Intronic
1199685131 X:150258767-150258789 CAGAAATGCAAAGATGAGGCTGG - Intergenic
1199825876 X:151498719-151498741 AAGAAACGCCACTATGAGGTAGG - Intergenic
1200400169 X:156015335-156015357 CAGAGATGCCCTCGTGAGGTCGG - Intergenic
1200697091 Y:6370532-6370554 CAGACAGGCCACCAAAAGGTTGG + Intergenic
1200700350 Y:6396899-6396921 CAGAAAAGCCACCAAAAGGTTGG + Intergenic
1200706476 Y:6447089-6447111 CAGACAGGCCACCAAAAGGTTGG + Intergenic
1201027636 Y:9717619-9717641 CAGACAGGCCACCAAAAGGTTGG - Intergenic
1201033761 Y:9767799-9767821 CAGAAAAGCCACCAAAAGGTTGG - Intergenic
1201037022 Y:9794167-9794189 CAGACAGGCCACCAAAAGGTTGG - Intergenic
1201284773 Y:12369553-12369575 CAGAAATCCCACCACCAGGTTGG - Intergenic
1201431049 Y:13902248-13902270 CAGAAATGCCACGATGCGCTTGG + Intergenic
1202178099 Y:22116086-22116108 CAGACAGGCCACCAAAAGGTTGG + Intergenic
1202180977 Y:22139633-22139655 CAGACAGGCCACCAAAAGGTTGG + Intergenic
1202210383 Y:22446767-22446789 CAGACAGGCCACCAAAAGGTTGG - Intergenic
1202213262 Y:22470309-22470331 CAGACAGGCCACCAAAAGGTTGG - Intergenic