ID: 969870919

View in Genome Browser
Species Human (GRCh38)
Location 4:10104154-10104176
Sequence TCTATCACCCAGAGATAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969870919_969870922 28 Left 969870919 4:10104154-10104176 CCTACCTATCTCTGGGTGATAGA 0: 1
1: 0
2: 1
3: 8
4: 98
Right 969870922 4:10104205-10104227 TAGTCTATGACTGTACAACAAGG 0: 1
1: 0
2: 0
3: 27
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969870919 Original CRISPR TCTATCACCCAGAGATAGGT AGG (reversed) Intronic
901488145 1:9579666-9579688 TCCTTCTCCCAGAGATAGGAGGG + Intronic
902743665 1:18458430-18458452 TCTATCACCTAGAGCTAAGAGGG + Intergenic
917045550 1:170856015-170856037 TCTTTCCCCCAGAGAGAGCTGGG - Intergenic
917138062 1:171806813-171806835 TCTTTCAGGCAGAGATTGGTAGG + Intronic
1063835539 10:10007543-10007565 TGTATCAGCCACAGATAGATTGG + Intergenic
1066426152 10:35309349-35309371 TCCATCACCCAGAGGCAGGTGGG - Intronic
1070273931 10:74986085-74986107 TCTAACAGCCAGAGATACTTAGG - Intronic
1073268685 10:102243712-102243734 TCTATCACCCAAAGAGAGTCAGG - Intergenic
1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG + Intronic
1073942743 10:108716586-108716608 TCTATCACTGAGAGATTAGTAGG + Intergenic
1077958241 11:7044466-7044488 TCTATTGCCCAGACATTGGTTGG + Intronic
1080322974 11:31036446-31036468 TCTGTCACAGAGACATAGGTGGG - Intronic
1082839846 11:57680036-57680058 TTCATCATCCAGGGATAGGTTGG + Intronic
1083063886 11:59903210-59903232 TCTGTCACCCAGTGATTGGAGGG - Intergenic
1083502062 11:63118480-63118502 TCTAGCACCAAGAGTTAGGATGG - Intronic
1084410551 11:69003909-69003931 TCTACAACCCAGCGATAGGCTGG - Intergenic
1084701613 11:70789790-70789812 TCCATCCTCCAGAGACAGGTAGG - Intronic
1084894481 11:72255626-72255648 TCTATGAACCAGGGCTAGGTTGG + Intergenic
1087193668 11:95283160-95283182 TTTATCCCCCACAGATAAGTGGG - Intergenic
1094438945 12:30453529-30453551 ATTATCACCCAGTGATAGGAGGG + Intergenic
1098736935 12:74117024-74117046 TCTATTACCCAGAAAAAGATGGG - Intergenic
1106450325 13:29875653-29875675 TCTAGCACGAAGAGATACGTAGG - Intergenic
1107704421 13:43085821-43085843 TGAATCACCCAGATAAAGGTAGG + Exonic
1112185182 13:97121185-97121207 TCTATCACCCAGTGAGAAATTGG + Intergenic
1112501285 13:99945255-99945277 TCTGTCACCCAGAGGTTGGAGGG - Intergenic
1116410669 14:44619100-44619122 TGTATCACCCAGACATACATAGG + Intergenic
1117013807 14:51497828-51497850 TATATTACCCAGAGATATTTTGG + Intronic
1124479177 15:30062795-30062817 GCTAGGACCCAGGGATAGGTAGG + Intergenic
1129246999 15:74285472-74285494 TCTATCACTCAGCCATAGGAAGG - Intronic
1130040211 15:80400039-80400061 TCTGTCCCACAGAGATAGGAAGG - Intronic
1130828469 15:87574122-87574144 TCTGTCTCTCAGAGGTAGGTAGG - Intergenic
1132220705 15:100103021-100103043 TCTGTCATCCAGAAAGAGGTGGG + Intronic
1138862162 16:60771576-60771598 TCCAAGACCCAGAGATAGGCAGG - Intergenic
1139956549 16:70695981-70696003 TCTGTCACCCAGAGACTGGCAGG - Intronic
1143383713 17:6512286-6512308 CCTATCACTCAGAGATAGATAGG + Intronic
1148288069 17:46414233-46414255 TGTAAAACCCAGTGATAGGTGGG + Intergenic
1148310239 17:46631817-46631839 TGTAAAACCCAGTGATAGGTGGG + Intronic
1156116952 18:33796938-33796960 TATATCATCCACAGATATGTAGG - Intergenic
1156202651 18:34852272-34852294 TCTACCACCCAGAAACAGGTAGG + Intronic
1156429300 18:37054152-37054174 TGTAAAACCCAGATATAGGTTGG + Intronic
1158021143 18:52843356-52843378 TCTAGCATCCAAATATAGGTAGG - Intronic
1158126793 18:54108789-54108811 CATATCCCCCAGAGATAAGTGGG - Intergenic
1161902811 19:7132163-7132185 TCTGTCACGTAGAAATAGGTGGG + Exonic
1164311193 19:24048040-24048062 TCTGTCACCCAGAGGTAGGTGGG + Intronic
1168513679 19:56993387-56993409 TGTATCCCCCAAAGAGAGGTTGG + Intergenic
928133971 2:28674218-28674240 CCTATCACGCAGAGATATGGAGG + Intergenic
928166411 2:28975775-28975797 TCTAGCACACAGATCTAGGTGGG + Intronic
940777617 2:157901262-157901284 TCTATGACCCAAGAATAGGTGGG + Intronic
944919805 2:204400939-204400961 TCTATCACCAAGAAAGAGATAGG - Intergenic
946230334 2:218287311-218287333 TCTATCACTCAGAGAGTGGGCGG - Intronic
947230334 2:227878151-227878173 TCTGTAACTCAGAGAAAGGTTGG - Intronic
947771669 2:232675342-232675364 TCTATGACTCTGAGATAGGATGG + Intronic
1170761807 20:19257624-19257646 TCCAGCACCCAGAAAAAGGTAGG - Intronic
1170776572 20:19379895-19379917 CCTATGACCCAGACATAGGCTGG + Intronic
1175920970 20:62450561-62450583 TGTCTCACCCAGAGTGAGGTTGG - Intergenic
1178354022 21:31895567-31895589 TCTGTCACACAGAGATGGATGGG - Intronic
1181847363 22:25722446-25722468 TCTAGCACCCAGAAACAGGGAGG + Exonic
1182914881 22:34020355-34020377 TCTTACACACAGAGATAAGTTGG + Intergenic
951778468 3:26336778-26336800 TCTATCAACCAGAAAAAGGTTGG - Intergenic
952690010 3:36194246-36194268 TCTAGGTCCCAGATATAGGTAGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956038200 3:65118362-65118384 TCTATAGCCCAGACACAGGTAGG + Intergenic
960939932 3:122926882-122926904 TCTGGCACCCAGTGAGAGGTGGG - Intronic
967447513 3:189584192-189584214 TCTATCACACAGAGGAAGGAAGG + Intergenic
968342983 3:197973580-197973602 TCTGTTACCTGGAGATAGGTTGG + Intronic
969870919 4:10104154-10104176 TCTATCACCCAGAGATAGGTAGG - Intronic
977486569 4:97655035-97655057 TCTATCAGCCAGAGATAACCAGG - Intronic
979555224 4:122038841-122038863 ATTAACACCCAGAGAAAGGTGGG - Intergenic
979731735 4:124031098-124031120 TTTATCACCCACAGATATATGGG - Intergenic
986153518 5:5150372-5150394 TTTATTACTTAGAGATAGGTAGG + Intronic
988013836 5:25527627-25527649 TCTCTTCCCCAGAGATTGGTGGG - Intergenic
989140025 5:38192786-38192808 TCCATCACCCAGAGATTCCTGGG + Intergenic
990306022 5:54494570-54494592 TCTATGACCCCGAAATATGTGGG - Intergenic
1001215380 5:169851289-169851311 TCTGTCACCCAGAGCTAGTAAGG - Intronic
1003393441 6:5732773-5732795 TTTTTCCACCAGAGATAGGTAGG + Intronic
1003693855 6:8382242-8382264 CCTACTACCTAGAGATAGGTGGG - Intergenic
1006087214 6:31604646-31604668 TCTCTCACCCAGAGAGAAATGGG - Intergenic
1008564327 6:52752195-52752217 TCTATCTCCCTGAGATCTGTAGG + Intronic
1012711110 6:102606719-102606741 TGTAACACCCTGAGATAAGTGGG + Intergenic
1013271972 6:108553926-108553948 TAAGTCACCCAGAGATTGGTGGG + Intergenic
1015080216 6:129215212-129215234 TCTATAACCTTGAGATATGTAGG - Intronic
1015107822 6:129557304-129557326 TCTAGCATCCACAGATAGGTAGG - Intergenic
1016421698 6:143891919-143891941 TCAATTACCCACAGATAGGGGGG - Intronic
1016830534 6:148429346-148429368 TCTGTCACCCAGGCCTAGGTTGG - Intronic
1023279298 7:38553337-38553359 TCTATCAGCCAGAGCTCGGCAGG - Intronic
1023723246 7:43116405-43116427 TCTATCAACCAGAGCTTGCTAGG + Intronic
1024986228 7:55195321-55195343 TCTGTTACCCAGAGATGGGAGGG + Intronic
1025115887 7:56257624-56257646 TTTATCACCCAGAGATGGGGGGG + Intergenic
1025283995 7:57648163-57648185 CCTATCATCCAGAAATAGGTTGG + Intergenic
1026200324 7:68208800-68208822 TTTATCACCCAGAGATGAGGCGG + Intergenic
1027426065 7:78062452-78062474 TGCACCACCCAGAGATAGGCTGG - Intronic
1031413489 7:121467948-121467970 TCTACCACCCAAATATAGGACGG - Intergenic
1031743109 7:125459143-125459165 ACTAACACTCAGAGAAAGGTGGG - Intergenic
1036422541 8:8611780-8611802 TCTGTCAGCCAGACAGAGGTAGG - Intergenic
1037353204 8:17986813-17986835 TCTAGCACCTAGAGATACATGGG + Intronic
1042225583 8:66512283-66512305 CCTTTCACCCAGAGATAAGGGGG + Intronic
1042263792 8:66887718-66887740 TTAATCTCCCAGAGATTGGTAGG + Intronic
1045165780 8:99603265-99603287 TGTATCACCCACAGATAAGAGGG - Intronic
1045829409 8:106440507-106440529 TCTATCACCCAGAACTAGAAAGG - Intronic
1058197158 9:101991779-101991801 TTTATCACACAGATATAGGAAGG + Intergenic
1185541078 X:903427-903449 TCTATCACCCAGAGTCTGGGAGG + Intergenic
1185952292 X:4450557-4450579 TATATCTCCCATAGATAAGTGGG - Intergenic
1186678702 X:11848565-11848587 TCTTTCATCCAGGGATATGTGGG + Intergenic
1188195727 X:27230524-27230546 GCTTTCCCCCACAGATAGGTTGG + Intergenic
1188278638 X:28235291-28235313 GCAATCACCCAGAGATAGCTTGG + Intergenic
1188788529 X:34379056-34379078 TCTATCCCCAAGGGAGAGGTTGG + Intergenic
1189276810 X:39792460-39792482 TCTATCTCCCCAAGATAGGAAGG + Intergenic
1195574099 X:106430616-106430638 TCTATCAGCTAGATATAGCTGGG + Intergenic