ID: 969871320

View in Genome Browser
Species Human (GRCh38)
Location 4:10106901-10106923
Sequence TGATGGGGACAGAGCCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969871320_969871324 -8 Left 969871320 4:10106901-10106923 CCTGTGAGGCTCTGTCCCCATCA 0: 1
1: 0
2: 0
3: 17
4: 256
Right 969871324 4:10106916-10106938 CCCCATCAGCTGGGTCGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969871320 Original CRISPR TGATGGGGACAGAGCCTCAC AGG (reversed) Intronic
900051564 1:601467-601489 GGATGGGTACAGACCCACACAGG - Intergenic
900126202 1:1069925-1069947 TGATGGGGCCGGGTCCTCACCGG - Intergenic
900360088 1:2284177-2284199 TGTTGGGGCCAGAGCCCCCCAGG - Intronic
900373147 1:2341177-2341199 TGCTGGGGACAGATCCACAAAGG - Intronic
901631447 1:10650048-10650070 CGGTGGGGAAGGAGCCTCACTGG - Intronic
901633218 1:10657908-10657930 AGGTGGTGTCAGAGCCTCACTGG + Intronic
901871289 1:12140558-12140580 TGATGGGGGCAGAGCCAGAGCGG + Intronic
902159787 1:14520597-14520619 TGATGGGGGCAGAGGCTCTGAGG + Intergenic
902299877 1:15494138-15494160 TGATTAGGGCAGAGCCTCAGGGG - Intronic
902888910 1:19427102-19427124 GGATGGTGCCACAGCCTCACCGG + Intronic
903390921 1:22963165-22963187 TGCCGGGGACACATCCTCACAGG + Exonic
903593104 1:24472111-24472133 TCATGGGGACAGTGCCACCCAGG + Intronic
905873983 1:41420560-41420582 TGATGGGGAGAGAGCCAGCCTGG - Intergenic
906608420 1:47186635-47186657 TGCTGGGGACAGACACACACAGG - Intronic
906726749 1:48049885-48049907 TGATGGGGACACAGCCTTTCTGG + Intergenic
907049715 1:51321882-51321904 TGGCTGGAACAGAGCCTCACAGG + Intronic
907985621 1:59526895-59526917 GGATGGGAATAGTGCCTCACAGG + Intronic
908912228 1:69085363-69085385 TGAAGGAGTCAGAGCCTCTCAGG - Intergenic
909792400 1:79695475-79695497 TGAAGGGGACAGATACTCAAAGG + Intergenic
914582364 1:149030432-149030454 TGATGGGGACAGAAACTAGCAGG - Intronic
914753271 1:150549695-150549717 TGATGGGGCCAGAGTTCCACGGG - Intronic
916065893 1:161135130-161135152 TTGGGGGGACAGAGTCTCACTGG - Intergenic
916443694 1:164852614-164852636 GGATCTGGACAGAGCCTCATAGG - Intronic
917696953 1:177534974-177534996 TGATGGAGACAGGGCCTGATGGG - Intergenic
918278615 1:182980386-182980408 TTTTTGAGACAGAGCCTCACTGG + Intergenic
918748614 1:188241158-188241180 TGTTGGAGACAGGGCCTCATGGG + Intergenic
921921579 1:220676090-220676112 TGAGGGGGACAGAGCATCCTTGG - Intergenic
922217657 1:223533639-223533661 TTATGAGGAAAGAGACTCACTGG - Intergenic
922468996 1:225864012-225864034 AAATGGGGACAAAACCTCACAGG - Intronic
922740396 1:228011079-228011101 TGGTGGGGAGACAGCCTGACTGG + Intronic
924442062 1:244094646-244094668 TGTTGGGACCAGAGGCTCACAGG - Intergenic
1063077233 10:2729581-2729603 TGATGGGGACACACGGTCACAGG - Intergenic
1063164027 10:3443498-3443520 TGCTGGTGACACAGCCTCAGGGG + Intergenic
1063171123 10:3510889-3510911 TGATGCAGACAAAACCTCACAGG - Intergenic
1065122304 10:22541975-22541997 TGATGTGGAGAGAGCCGAACAGG - Exonic
1067327320 10:45281672-45281694 GGATGGGGACAAATCCTTACCGG - Intergenic
1067751506 10:48974841-48974863 GCCTGGGGACAGAGACTCACAGG - Exonic
1068837932 10:61575925-61575947 TGATGGGGACAGACTCATACTGG + Intergenic
1068866804 10:61903271-61903293 GGGAGGGGACAGAGCCTCCCCGG + Intronic
1069879258 10:71581473-71581495 TGGAGGGGACAGGGCCTCAGGGG - Intronic
1074216110 10:111385679-111385701 AGATGAGGAGAGAGCCTCATAGG + Intergenic
1076354311 10:129840979-129841001 TGCTGGGGACGTAGCCTCGCGGG + Exonic
1077313700 11:1905834-1905856 TGGGGGGGACAGGGTCTCACTGG + Intergenic
1077474160 11:2778552-2778574 TGATGGGCACAGAGCCTGGTGGG - Intronic
1078372357 11:10759430-10759452 TGGTGGGGTGAGAGCTTCACTGG + Intronic
1078577894 11:12517129-12517151 TGGAGGGGACAGAGCCTGAGTGG - Intronic
1080062042 11:27967114-27967136 TAATGGGGACAGAAAGTCACAGG + Intergenic
1080585301 11:33676316-33676338 TCATGGGGATACAGCCTCAAGGG - Intergenic
1081632385 11:44698740-44698762 TTGTGGGGACAGTTCCTCACTGG + Intergenic
1086961146 11:92981104-92981126 TGATAGGCACAGATGCTCACGGG - Intronic
1088805604 11:113349222-113349244 TGAGGGGACCAGAGTCTCACTGG - Intronic
1091120478 11:133053492-133053514 AAATGGGAACAGAGCCTGACTGG - Intronic
1091309499 11:134562495-134562517 GGATGGGGACTGAGGCCCACAGG + Intergenic
1091488026 12:908537-908559 AGATGGGGGCAGAGCCACCCAGG - Exonic
1092131106 12:6114003-6114025 TGATGGGGAGACAGGCTCAGTGG - Intronic
1092148076 12:6228510-6228532 GGCTGGAGACAGAGCCTCAGTGG - Intronic
1093078449 12:14781662-14781684 TGCTGGGGAAAGAGTGTCACTGG + Intergenic
1094298772 12:28937481-28937503 AGATGGGCACAGATCCTCAGTGG - Intergenic
1095905987 12:47378468-47378490 TGATGCGGCCAGAGCCTTCCTGG + Intergenic
1096393339 12:51246779-51246801 TTCTGGGGACAGGGCCTCAGTGG + Exonic
1096637190 12:52967766-52967788 TCAGGGGGACACAGCCTCCCCGG - Intergenic
1096814837 12:54195637-54195659 TGATGGGGGCAGAGGCTGAGAGG - Intergenic
1100004676 12:89880679-89880701 TCTTGGGGACAAATCCTCACAGG + Intergenic
1100383047 12:94079732-94079754 TGTTGTGAACAGAGCCTCACCGG + Intergenic
1101082984 12:101208323-101208345 TGCTGGGGACAGGGCCTTAACGG - Intronic
1101577070 12:106007493-106007515 AGAAGGGGACAGACCCTCAAAGG + Intergenic
1101736272 12:107465612-107465634 AAATGAGGACAGAGCATCACAGG - Intronic
1101897497 12:108767572-108767594 TGATGTGGACAGGGCATCACTGG - Intergenic
1101966021 12:109282494-109282516 TCATCGGGACAGTGCCTTACAGG + Intronic
1102148091 12:110669678-110669700 TGGTGGGGACAGTGTCTCAGTGG - Intronic
1103929080 12:124439780-124439802 GGAAGGGGACAGAGACTCAGAGG + Intronic
1106504312 13:30357679-30357701 TGCTTGGGACAGGGCCTCCCAGG + Intergenic
1108588110 13:51888964-51888986 TAATGGCCACAGAGCCTCTCTGG + Intergenic
1108716161 13:53080230-53080252 TGATGAGAAGAAAGCCTCACTGG + Intergenic
1111699460 13:91667873-91667895 TGCAGGGTCCAGAGCCTCACTGG - Intronic
1112376129 13:98843020-98843042 TGATGGGGACAGACCTACAAAGG + Intronic
1112632822 13:101180703-101180725 TGATGGGGAGAGAACCTTGCTGG - Intronic
1112807844 13:103182686-103182708 TGATGGGCTCAGCACCTCACAGG + Intergenic
1113091006 13:106617653-106617675 TGAAAGGGAGAAAGCCTCACTGG - Intergenic
1113163989 13:107416964-107416986 TGATGGGAACCCACCCTCACTGG - Intronic
1114635801 14:24186130-24186152 AGCTGGGGACAGAGCTTCTCGGG + Exonic
1115622726 14:35156185-35156207 TGTTGGGGACATAGGCTCTCAGG - Intronic
1118501928 14:66370166-66370188 TGGTTGGGAAAGAGGCTCACTGG - Intergenic
1121518574 14:94570195-94570217 AGGAGGGGACAGTGCCTCACTGG - Intronic
1121567266 14:94919369-94919391 TGATGGGGGCAGAGCTTCTTTGG + Intergenic
1122786840 14:104167866-104167888 TGTGGGGCACAGAGCCTCCCGGG - Intronic
1123797576 15:23787802-23787824 GGATGAGGATAGAGACTCACAGG - Intergenic
1124378096 15:29141316-29141338 GGAAGGGGACTGAGACTCACAGG - Intronic
1127481453 15:59381239-59381261 AGATGGGGACAGAGTCTCTGGGG + Intronic
1127766480 15:62190134-62190156 GGATGAGTACAGACCCTCACAGG - Intergenic
1127844027 15:62854098-62854120 TGATTAGGACAGAGGCTCAGGGG - Intergenic
1129302579 15:74634102-74634124 TGGTAGGGACAGAGTCTGACTGG - Intronic
1129606216 15:77026293-77026315 GGATGGGGGCTGAGCCTCTCAGG + Intronic
1129680872 15:77657698-77657720 TGAGGGGGAGAGATCCTCAGAGG - Intronic
1130226652 15:82064066-82064088 TGATGGGGACGGAGACCCTCTGG - Intergenic
1131960445 15:97784954-97784976 TGATGTGGACAGCATCTCACAGG - Intergenic
1132098609 15:99006871-99006893 AGATGGGGACAGAGAATCATGGG - Intronic
1132139803 15:99383113-99383135 TGATGGGGACAGAGGGACAGGGG - Intronic
1132145503 15:99426893-99426915 TGATGAGGAGAGAGCATCCCGGG + Intergenic
1137600115 16:49750651-49750673 TGAGGTGGACAGATCCTCTCAGG + Intronic
1139362118 16:66406439-66406461 AGATGTGGCCAGAGCCACACAGG + Intergenic
1139920521 16:70457079-70457101 AGATGGGGACAGAGCCTTTTGGG + Intronic
1140263059 16:73397354-73397376 TGATGGGGTCAGAGGGTCACTGG + Intergenic
1142625137 17:1187079-1187101 TGATGGGGACAGGGCCAGCCTGG - Intronic
1145086653 17:19947943-19947965 TTATGGGGACAATGCCTCAAAGG + Intronic
1145258562 17:21341373-21341395 TGTTGGGGCCTGAGCCTCATTGG - Intergenic
1145318063 17:21746632-21746654 TGTTGGGGCCTGAGCCTCATTGG + Intergenic
1146435071 17:32837653-32837675 TGATGCAGACAGAGCCAAACTGG + Intronic
1148163438 17:45465303-45465325 TGAATGGGACAGAGAGTCACTGG + Intronic
1150394666 17:64811955-64811977 TGAATGGGACAGAGAGTCACTGG + Intergenic
1150575056 17:66423210-66423232 TGATGCTGAGAGAGTCTCACCGG + Intronic
1150589073 17:66545624-66545646 TGATATTGACAGAGCCTCAGTGG - Intronic
1150720031 17:67606573-67606595 AGATGGAGACACAGCCTTACAGG - Intronic
1151991730 17:77579396-77579418 TCATGGGAACAGAGCGTCTCAGG - Intergenic
1152014964 17:77744535-77744557 AGATGGGAAGACAGCCTCACCGG - Intergenic
1152163372 17:78683731-78683753 TGGTGGGGACAGGCCCTCAGGGG + Intronic
1152207191 17:78980565-78980587 GGCGGGGGACAGAGCCTCTCTGG + Intergenic
1152566659 17:81103336-81103358 GGTTGGGGTCAGAGGCTCACGGG + Intronic
1152948649 17:83212456-83212478 GGATGGGTACAGACCCACACAGG + Intergenic
1153846025 18:9050775-9050797 TGATGGGGGCACTGCCTCAAAGG - Intergenic
1156189509 18:34702074-34702096 AGATGGGGACAGGGTCACACAGG - Intronic
1156518897 18:37704941-37704963 TTATGGGGACAGGGCCTAAGTGG + Intergenic
1158213766 18:55078758-55078780 TAATGGGGAGAGAGACTAACGGG - Intergenic
1159558293 18:69967669-69967691 TGCTGGTGAAGGAGCCTCACAGG - Intergenic
1160465770 18:79074555-79074577 TGAGGGGCACAGAGCCTTACTGG + Intronic
1160798518 19:956587-956609 TGAAGGGGAAAGGGCCTCCCCGG + Intronic
1162061734 19:8100221-8100243 TCATGGGGACAGAGTTTCAGTGG + Intronic
1162127357 19:8506654-8506676 TGATGGGGACAAAGACTCCTGGG + Intergenic
1162551810 19:11362182-11362204 AGATGGGGACAGACACTTACTGG - Intronic
1162964906 19:14151062-14151084 GGGTGGGGGCAGGGCCTCACTGG + Exonic
1165889421 19:39101501-39101523 TGATGTGGACAGGCCCTCGCGGG - Exonic
1165981921 19:39731718-39731740 AGAGAGTGACAGAGCCTCACTGG - Intronic
925420597 2:3707663-3707685 TGAGGCGGACAGGGCCTCACAGG - Intronic
925703025 2:6658031-6658053 TGCTGTGGACACAGTCTCACAGG - Intergenic
927108291 2:19846106-19846128 TCCTGGGGACACAGCCTCGCTGG + Intergenic
927198739 2:20565580-20565602 TGGTGGGGACAGCCCCTCCCGGG + Intronic
927485595 2:23486481-23486503 TTCTAGGGACAGAGCCTGACTGG - Intronic
928858027 2:35823620-35823642 TTATGTAGACAAAGCCTCACTGG - Intergenic
929605455 2:43231195-43231217 TGAAGGTGACAGAGCATCTCAGG + Exonic
932619782 2:73258694-73258716 TGGTGGTGACAGCTCCTCACTGG + Exonic
934504801 2:94881271-94881293 TGATGAGGACACAGCTTCGCAGG - Intergenic
935946950 2:108295356-108295378 CTATGGGGTCAGAGCCCCACAGG - Intronic
938083284 2:128381519-128381541 TGATGTGGAATGAGACTCACGGG + Intergenic
938316885 2:130335867-130335889 TGCTGGGGACATAGCCTTAAGGG - Intergenic
942340331 2:174937638-174937660 TGTTGGGGACAGAGCCTGGTGGG + Intronic
943753922 2:191538528-191538550 TGCTGGGAATAGAGACTCACAGG - Intergenic
947581920 2:231325542-231325564 TCCAGGGGACAGAGCCTCAGAGG - Intronic
947791894 2:232873371-232873393 AGATGGGGACAGGGCCTGAGTGG + Intronic
947818339 2:233053227-233053249 TGATGGGGGAAGAGTCTCCCAGG + Intergenic
1168999525 20:2157506-2157528 TGTTGGAGCCAGAGGCTCACAGG + Intronic
1171409711 20:24937858-24937880 TGCTGGGGAAAGAGGCTGACTGG + Intergenic
1172437733 20:34942035-34942057 GGGTGGGGACAGAGGCTCTCAGG - Intronic
1173398145 20:42700319-42700341 TGATGGGGGCTGAGGCTCAGTGG - Intronic
1175230436 20:57470408-57470430 AGATGGGGAAAGAGGCTCACTGG - Intergenic
1175923286 20:62459766-62459788 TGCTGGTGCCACAGCCTCACAGG - Intergenic
1176177803 20:63736928-63736950 AGAAGGGGACAGATCCTCTCTGG + Intronic
1176909940 21:14552425-14552447 TCATGGGGACAGAGCCTTTATGG + Intronic
1178330744 21:31689002-31689024 TGATGGAGCCAGAGCCTCAGAGG - Intronic
1179825154 21:43960370-43960392 TCATGTGGACAGAGACTCAGAGG + Intronic
1180077816 21:45472076-45472098 TGGGGGGGTCAGGGCCTCACGGG + Intronic
1181805448 22:25372087-25372109 TGGAGGGGAGAGAGCATCACTGG - Intronic
1182414327 22:30211236-30211258 TAATGGGGACAGAGTTTCACTGG + Intergenic
1182957852 22:34443778-34443800 TGATGGGTAAAGAGCATCAAAGG - Intergenic
1183492059 22:38122070-38122092 TGCTGGGGACAGAGTCCCATGGG - Intronic
1183949686 22:41345904-41345926 TCATGGGGCCAGAGCCCCACAGG + Intronic
1185041277 22:48505703-48505725 GGATGGGGACAGAGATGCACAGG - Intronic
1185349446 22:50326956-50326978 TGTTGGGCACAGGGCCTCGCCGG - Exonic
949860995 3:8504599-8504621 GGCTGGGGAAAGAGACTCACTGG + Intronic
950198816 3:11028509-11028531 TGATGGCCACAGCTCCTCACTGG + Intronic
950429763 3:12944034-12944056 TGATGAGGGCAGAGCCACAGAGG - Intronic
950469986 3:13178598-13178620 TGATGAGAACAGAGCCCCAGGGG - Intergenic
950491680 3:13309105-13309127 AGATGGGAACAAAGCCCCACTGG - Intergenic
950497429 3:13342129-13342151 TCATGGGGACAGAGGTTCAGGGG + Intronic
951920589 3:27850126-27850148 TGAAAAGGAGAGAGCCTCACAGG - Intergenic
954784161 3:53081002-53081024 TGATGGGGACAGAGCAGCCTAGG + Intronic
955944417 3:64178767-64178789 TGTTGGGACCAGAGGCTCACAGG - Intronic
958856670 3:99393883-99393905 AGATGGGGACAGATCCTGAGAGG + Intergenic
960805085 3:121575895-121575917 TGTTTGAGACAGAGTCTCACCGG - Intronic
961459452 3:127041019-127041041 GGATGGGGACAGAGCTTCAGTGG + Intergenic
961536389 3:127573393-127573415 TGGTGGGAACAGGGCCACACAGG + Exonic
962072679 3:132048027-132048049 AGATCAAGACAGAGCCTCACAGG - Intronic
962957945 3:140283557-140283579 AGATGGTGGCAGAGCCACACTGG + Intronic
963049478 3:141128746-141128768 TAAGGGGGACAGAGCATCATGGG + Intronic
966325039 3:178744636-178744658 TGCTTGGAACAGAGGCTCACTGG + Intronic
967094397 3:186164899-186164921 TGATGGTGACAGAGGCGCACTGG + Exonic
968054189 3:195678606-195678628 TGCTGGGGACGGAGCTTCTCCGG - Intergenic
968101701 3:195970536-195970558 TGCTGGGGACGGAGCTTCTCCGG + Intergenic
968886277 4:3335504-3335526 CCCTGGGGACAGAGCCTGACAGG - Intronic
969100114 4:4762493-4762515 CGTTGGGGACAGAGCCAGACTGG - Intergenic
969272044 4:6109579-6109601 GCATGGGTACAGAGCCTCACAGG - Intronic
969871320 4:10106901-10106923 TGATGGGGACAGAGCCTCACAGG - Intronic
970541962 4:17089120-17089142 TGATGGGGACATAGACATACAGG - Intergenic
972917783 4:43902785-43902807 TGTTGTGAACAGAGGCTCACAGG - Intergenic
977884039 4:102237469-102237491 TGAAGGGGACATAGCCTGAGGGG - Intergenic
981142426 4:141284164-141284186 AGATGTGAACAGAGGCTCACAGG + Intergenic
981682248 4:147412609-147412631 TGCTGTGAACAGAGGCTCACAGG + Intergenic
983357314 4:166680295-166680317 TGATGGGGTCAGATCCTCCATGG + Intergenic
983675319 4:170285780-170285802 TGATGAGGACAGAGGCTGAGCGG - Intergenic
985531581 5:436753-436775 CGATGGGGACAGAGCTACCCAGG + Exonic
985672213 5:1212917-1212939 GAACGGGGACAGGGCCTCACAGG - Intronic
985736899 5:1588438-1588460 TGCTGGGGACTGAGCTTCTCCGG + Intergenic
985860267 5:2465181-2465203 TGGTGTGGAAACAGCCTCACTGG + Intergenic
987235788 5:15940045-15940067 TTTTGGAGACAGAGTCTCACAGG - Intergenic
987337797 5:16912366-16912388 TGGTGGGGACTGTGGCTCACCGG - Intronic
993164864 5:84339420-84339442 TGATGGGTACAGTGCCTGAGAGG - Intronic
995103937 5:108352100-108352122 TGTGGGGAACAGTGCCTCACAGG + Intronic
995256852 5:110056756-110056778 TGTTGGGGACAGAATCCCACTGG - Intergenic
995502544 5:112823395-112823417 TGCTGGGGACATAGCCACAGGGG + Intronic
998160733 5:139811427-139811449 GGGTGGGGCCAGAGCCTCAGGGG + Intronic
1001635391 5:173206409-173206431 TAATGGGGACAGGGCGGCACAGG + Intergenic
1004078993 6:12372275-12372297 TGATGGGGACAGAGATGCTCTGG - Intergenic
1005933460 6:30500590-30500612 TGATGGGGAGAGAGTCAGACAGG - Intergenic
1007466053 6:42051938-42051960 TGTTGGAGATGGAGCCTCACAGG - Intronic
1007590995 6:43020944-43020966 GGATGGGGACAGAGCACCAAGGG - Exonic
1012105793 6:95156509-95156531 TTCTGGGGCTAGAGCCTCACTGG - Intergenic
1015129689 6:129795281-129795303 TGATGGTGGCAGTGCCTCAATGG - Intergenic
1015853447 6:137598816-137598838 TGATGGGGGCAGAGCCTAAAAGG - Intergenic
1015872968 6:137795543-137795565 TGCTGTGAACAGAGGCTCACAGG - Intergenic
1016908558 6:149174978-149175000 GGATGGGGACAGAGAGTGACAGG - Intergenic
1017523995 6:155226812-155226834 TGATGGGGACAGACACACAGGGG - Intronic
1018006577 6:159627844-159627866 TTATGGGGTCAGAGACACACTGG - Intergenic
1019247960 6:170721394-170721416 GGATGGGTACAGACCCACACAGG + Intergenic
1032455778 7:132072543-132072565 AGATGGGGACAGAGACGTACTGG - Intergenic
1032657596 7:133948369-133948391 TGAGGGAGACAGATCCTGACAGG + Intronic
1033245198 7:139712032-139712054 TGCTGGGAACAGAGTCTCCCTGG - Intronic
1033348175 7:140541398-140541420 TGGTGGGGACAGAGTCCCCCGGG - Intronic
1033392379 7:140940241-140940263 TGTTGGGGAAAGAGTTTCACTGG - Intergenic
1035500153 8:86470-86492 GGATGGGTACAGACCCACACAGG - Intergenic
1036278692 8:7380009-7380031 TGATGGGGACCAAGCTACACTGG - Intronic
1036342831 8:7931859-7931881 TGATGGGGACCAAGCTACACTGG + Intronic
1036568153 8:9955928-9955950 TTATGGGGACAGTGGCTCCCAGG - Intergenic
1036738993 8:11345258-11345280 TGAGGAGGACACAGGCTCACTGG + Intergenic
1036838171 8:12092614-12092636 TGATGGGGACCAAGCTACACTGG + Intergenic
1036859961 8:12338862-12338884 TGATGGGGACCAAGCTACACTGG + Intergenic
1037580851 8:20245371-20245393 TGATGGGAAAAGAGCAGCACCGG - Intergenic
1037687904 8:21159251-21159273 GGATGCCGACAGACCCTCACTGG + Intergenic
1037812131 8:22093133-22093155 TGCTGGGGACTGAACCTCACTGG + Intronic
1039393655 8:37204074-37204096 TTTTGGAGACAGAGTCTCACTGG - Intergenic
1039614300 8:38942659-38942681 TGATGGAGGCTGAGCCTCCCTGG - Intronic
1039862819 8:41473665-41473687 TTATGGGGAAAGAGGCTCAGAGG - Intergenic
1040042018 8:42925841-42925863 TGATGTGGACACAGGCACACTGG - Intronic
1040713819 8:50222716-50222738 TGATGCAGACAGACCCTCAGCGG + Intronic
1041111772 8:54489563-54489585 TTTTTGAGACAGAGCCTCACTGG + Intergenic
1041339748 8:56831877-56831899 TGATGGGCTCAGAGACTCATAGG + Intergenic
1041566905 8:59288962-59288984 TGATGGGGATAGATCCTGGCAGG - Intergenic
1041970990 8:63742554-63742576 TGCTGGGGACAGAGGGTTACAGG + Intergenic
1043024725 8:75051635-75051657 TGATGGAGACAGTCCCTGACAGG + Intergenic
1047489947 8:125366115-125366137 TGCTGGGGCCACAGCTTCACTGG - Intronic
1049794138 8:144488849-144488871 CGCTGGGGACAGAGCCCCAGGGG + Intronic
1051100569 9:13516236-13516258 TCCTGTGGACAGAGCCTAACAGG - Intergenic
1052732540 9:32306736-32306758 GGATGGTTTCAGAGCCTCACAGG - Intergenic
1052991166 9:34520204-34520226 GGCTGTGGACAGAGCCTCAGGGG - Intronic
1056401141 9:86228616-86228638 AGATGGGGACAGGTCCTCTCAGG - Intronic
1057214511 9:93220539-93220561 TGATGGGCAGAGAGACTAACTGG + Intronic
1058866316 9:109165390-109165412 TGATGAGGACAAAGCCTCAGGGG + Intronic
1059014904 9:110505132-110505154 TGTTGAGGACAGAGACTCAAAGG - Intronic
1060239331 9:121889494-121889516 TGATAGGGACAGAGTTTCAGTGG - Intronic
1060321470 9:122565382-122565404 GGCTGGGGAAAGAGACTCACTGG - Intergenic
1060395155 9:123311394-123311416 TGCTGTGGAGAGAGCCGCACTGG + Intergenic
1060889904 9:127181471-127181493 CTGTGGGGACAGAGCCTCAGAGG - Intronic
1061264272 9:129496500-129496522 CCACGGGGAGAGAGCCTCACCGG + Intergenic
1061895352 9:133644117-133644139 TGTTGGGGCCTGAGCCTCAGGGG - Intronic
1203608729 Un_KI270748v1:76873-76895 GGATGGGTACAGACCCACACAGG + Intergenic
1187639126 X:21267905-21267927 TGATGGGGATTGAGTCTCATTGG + Intergenic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1189705647 X:43756315-43756337 GGGTGGAGAAAGAGCCTCACTGG + Intergenic
1190237126 X:48624922-48624944 TGATGTGCACTGAGCGTCACTGG - Intergenic
1190362896 X:49665994-49666016 GGATGGGGACAGAGCCTGCATGG + Intergenic
1192540863 X:71971543-71971565 TGTTGGGAACAGAGCTGCACTGG - Intergenic
1194646112 X:96460379-96460401 TGAAAGGGACAGAGACTCAGGGG - Intergenic
1195079120 X:101354713-101354735 TGCTGGGGACGGAGTCTCACTGG - Intronic
1197760472 X:130024477-130024499 TCTTGGGGACAGAGCCACCCCGG - Intronic
1197912419 X:131497722-131497744 TGATGGGGATAGCACATCACTGG + Intergenic
1200665128 Y:6012720-6012742 TGATGGCCAAAGAGCTTCACTGG + Intergenic