ID: 969874717

View in Genome Browser
Species Human (GRCh38)
Location 4:10127553-10127575
Sequence GTTTCTCAGGGGGTTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969874705_969874717 22 Left 969874705 4:10127508-10127530 CCTGCCAGCCTGAGTTCCCTTAG No data
Right 969874717 4:10127553-10127575 GTTTCTCAGGGGGTTGTGGCAGG No data
969874707_969874717 14 Left 969874707 4:10127516-10127538 CCTGAGTTCCCTTAGTATTTATT No data
Right 969874717 4:10127553-10127575 GTTTCTCAGGGGGTTGTGGCAGG No data
969874709_969874717 5 Left 969874709 4:10127525-10127547 CCTTAGTATTTATTGATCATTTT 0: 17
1: 160
2: 325
3: 203
4: 909
Right 969874717 4:10127553-10127575 GTTTCTCAGGGGGTTGTGGCAGG No data
969874708_969874717 6 Left 969874708 4:10127524-10127546 CCCTTAGTATTTATTGATCATTT 0: 52
1: 280
2: 196
3: 206
4: 930
Right 969874717 4:10127553-10127575 GTTTCTCAGGGGGTTGTGGCAGG No data
969874706_969874717 18 Left 969874706 4:10127512-10127534 CCAGCCTGAGTTCCCTTAGTATT No data
Right 969874717 4:10127553-10127575 GTTTCTCAGGGGGTTGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969874717 Original CRISPR GTTTCTCAGGGGGTTGTGGC AGG Intergenic
No off target data available for this crispr