ID: 969875356

View in Genome Browser
Species Human (GRCh38)
Location 4:10132125-10132147
Sequence CTCCAGAATGGGGTCTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969875346_969875356 6 Left 969875346 4:10132096-10132118 CCATGTAATCCATACAGAGACGT No data
Right 969875356 4:10132125-10132147 CTCCAGAATGGGGTCTTGGGGGG No data
969875347_969875356 -3 Left 969875347 4:10132105-10132127 CCATACAGAGACGTTTGAGCCTC No data
Right 969875356 4:10132125-10132147 CTCCAGAATGGGGTCTTGGGGGG No data
969875345_969875356 13 Left 969875345 4:10132089-10132111 CCTTTCTCCATGTAATCCATACA No data
Right 969875356 4:10132125-10132147 CTCCAGAATGGGGTCTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969875356 Original CRISPR CTCCAGAATGGGGTCTTGGG GGG Intergenic
No off target data available for this crispr