ID: 969876508

View in Genome Browser
Species Human (GRCh38)
Location 4:10139538-10139560
Sequence TGGGGGTCCCAGGAGCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969876506_969876508 -8 Left 969876506 4:10139523-10139545 CCTAGACTGACACTCTGGGGGTC No data
Right 969876508 4:10139538-10139560 TGGGGGTCCCAGGAGCATCTTGG No data
969876497_969876508 12 Left 969876497 4:10139503-10139525 CCTCTCGACACCCTAACTCCCCT No data
Right 969876508 4:10139538-10139560 TGGGGGTCCCAGGAGCATCTTGG No data
969876499_969876508 1 Left 969876499 4:10139514-10139536 CCTAACTCCCCTAGACTGACACT No data
Right 969876508 4:10139538-10139560 TGGGGGTCCCAGGAGCATCTTGG No data
969876498_969876508 2 Left 969876498 4:10139513-10139535 CCCTAACTCCCCTAGACTGACAC No data
Right 969876508 4:10139538-10139560 TGGGGGTCCCAGGAGCATCTTGG No data
969876505_969876508 -7 Left 969876505 4:10139522-10139544 CCCTAGACTGACACTCTGGGGGT No data
Right 969876508 4:10139538-10139560 TGGGGGTCCCAGGAGCATCTTGG No data
969876503_969876508 -6 Left 969876503 4:10139521-10139543 CCCCTAGACTGACACTCTGGGGG No data
Right 969876508 4:10139538-10139560 TGGGGGTCCCAGGAGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969876508 Original CRISPR TGGGGGTCCCAGGAGCATCT TGG Intergenic
No off target data available for this crispr