ID: 969881146

View in Genome Browser
Species Human (GRCh38)
Location 4:10175096-10175118
Sequence GAACTTTGTGTTTCCAGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969881146_969881150 24 Left 969881146 4:10175096-10175118 CCTAGACTGGAAACACAAAGTTC No data
Right 969881150 4:10175143-10175165 TAATGTGGTGTGAGACCTTATGG No data
969881146_969881148 1 Left 969881146 4:10175096-10175118 CCTAGACTGGAAACACAAAGTTC No data
Right 969881148 4:10175120-10175142 CTGTGAATCTCGTCTGAGATGGG No data
969881146_969881149 9 Left 969881146 4:10175096-10175118 CCTAGACTGGAAACACAAAGTTC No data
Right 969881149 4:10175128-10175150 CTCGTCTGAGATGGGTAATGTGG No data
969881146_969881147 0 Left 969881146 4:10175096-10175118 CCTAGACTGGAAACACAAAGTTC No data
Right 969881147 4:10175119-10175141 TCTGTGAATCTCGTCTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969881146 Original CRISPR GAACTTTGTGTTTCCAGTCT AGG (reversed) Intergenic
No off target data available for this crispr