ID: 969881149

View in Genome Browser
Species Human (GRCh38)
Location 4:10175128-10175150
Sequence CTCGTCTGAGATGGGTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969881146_969881149 9 Left 969881146 4:10175096-10175118 CCTAGACTGGAAACACAAAGTTC No data
Right 969881149 4:10175128-10175150 CTCGTCTGAGATGGGTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969881149 Original CRISPR CTCGTCTGAGATGGGTAATG TGG Intergenic
No off target data available for this crispr