ID: 969881342

View in Genome Browser
Species Human (GRCh38)
Location 4:10176738-10176760
Sequence CTAGATCAGAAACTTTTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969881338_969881342 21 Left 969881338 4:10176694-10176716 CCAAAGTCCTCAAATTACATGTA No data
Right 969881342 4:10176738-10176760 CTAGATCAGAAACTTTTAATTGG No data
969881339_969881342 14 Left 969881339 4:10176701-10176723 CCTCAAATTACATGTATATCTGA No data
Right 969881342 4:10176738-10176760 CTAGATCAGAAACTTTTAATTGG No data
969881337_969881342 24 Left 969881337 4:10176691-10176713 CCTCCAAAGTCCTCAAATTACAT No data
Right 969881342 4:10176738-10176760 CTAGATCAGAAACTTTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969881342 Original CRISPR CTAGATCAGAAACTTTTAAT TGG Intergenic
No off target data available for this crispr