ID: 969883170

View in Genome Browser
Species Human (GRCh38)
Location 4:10192469-10192491
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969883166_969883170 14 Left 969883166 4:10192432-10192454 CCTTTTGCTTCCTGAAACATGGC No data
Right 969883170 4:10192469-10192491 AATTTGCAGGAACACTCACACGG No data
969883167_969883170 4 Left 969883167 4:10192442-10192464 CCTGAAACATGGCTCAAACACTT No data
Right 969883170 4:10192469-10192491 AATTTGCAGGAACACTCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr