ID: 969886061

View in Genome Browser
Species Human (GRCh38)
Location 4:10216627-10216649
Sequence ATGTGCCTGTAGAAGGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969886061_969886065 -10 Left 969886061 4:10216627-10216649 CCCTGACCCTTCTACAGGCACAT No data
Right 969886065 4:10216640-10216662 ACAGGCACATCCCTTATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969886061 Original CRISPR ATGTGCCTGTAGAAGGGTCA GGG (reversed) Intergenic
No off target data available for this crispr