ID: 969888677

View in Genome Browser
Species Human (GRCh38)
Location 4:10239666-10239688
Sequence GCAGACTGACTAGCAAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969888671_969888677 26 Left 969888671 4:10239617-10239639 CCCGGAACCAAGCTGGGTTCAGC No data
Right 969888677 4:10239666-10239688 GCAGACTGACTAGCAAAGACTGG No data
969888672_969888677 25 Left 969888672 4:10239618-10239640 CCGGAACCAAGCTGGGTTCAGCT No data
Right 969888677 4:10239666-10239688 GCAGACTGACTAGCAAAGACTGG No data
969888673_969888677 19 Left 969888673 4:10239624-10239646 CCAAGCTGGGTTCAGCTGCGTTT No data
Right 969888677 4:10239666-10239688 GCAGACTGACTAGCAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969888677 Original CRISPR GCAGACTGACTAGCAAAGAC TGG Intergenic
No off target data available for this crispr