ID: 969892960

View in Genome Browser
Species Human (GRCh38)
Location 4:10276683-10276705
Sequence AGTGACATGCTCTAGGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969892960_969892962 1 Left 969892960 4:10276683-10276705 CCATTAACCTAGAGCATGTCACT No data
Right 969892962 4:10276707-10276729 ATGAGCTGCCCTGCCACTCGTGG No data
969892960_969892967 21 Left 969892960 4:10276683-10276705 CCATTAACCTAGAGCATGTCACT No data
Right 969892967 4:10276727-10276749 TGGGCCCTGAGCTACATTTGAGG No data
969892960_969892969 23 Left 969892960 4:10276683-10276705 CCATTAACCTAGAGCATGTCACT No data
Right 969892969 4:10276729-10276751 GGCCCTGAGCTACATTTGAGGGG No data
969892960_969892963 2 Left 969892960 4:10276683-10276705 CCATTAACCTAGAGCATGTCACT No data
Right 969892963 4:10276708-10276730 TGAGCTGCCCTGCCACTCGTGGG No data
969892960_969892968 22 Left 969892960 4:10276683-10276705 CCATTAACCTAGAGCATGTCACT No data
Right 969892968 4:10276728-10276750 GGGCCCTGAGCTACATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969892960 Original CRISPR AGTGACATGCTCTAGGTTAA TGG (reversed) Intergenic
No off target data available for this crispr