ID: 969893540

View in Genome Browser
Species Human (GRCh38)
Location 4:10281604-10281626
Sequence ACATGCCAGTGGCACATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969893540_969893543 4 Left 969893540 4:10281604-10281626 CCCTAAATGTGCCACTGGCATGT No data
Right 969893543 4:10281631-10281653 TAACACGCTCAGAGTCTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969893540 Original CRISPR ACATGCCAGTGGCACATTTA GGG (reversed) Intergenic
No off target data available for this crispr