ID: 969897038

View in Genome Browser
Species Human (GRCh38)
Location 4:10315084-10315106
Sequence CCAGATCACCACATATATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969897034_969897038 1 Left 969897034 4:10315060-10315082 CCACACTGTGGAGATATGCCAAG No data
Right 969897038 4:10315084-10315106 CCAGATCACCACATATATATAGG No data
969897033_969897038 2 Left 969897033 4:10315059-10315081 CCCACACTGTGGAGATATGCCAA No data
Right 969897038 4:10315084-10315106 CCAGATCACCACATATATATAGG No data
969897032_969897038 3 Left 969897032 4:10315058-10315080 CCCCACACTGTGGAGATATGCCA No data
Right 969897038 4:10315084-10315106 CCAGATCACCACATATATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969897038 Original CRISPR CCAGATCACCACATATATAT AGG Intergenic
No off target data available for this crispr