ID: 969897334

View in Genome Browser
Species Human (GRCh38)
Location 4:10317610-10317632
Sequence CCAGGCATGAAAGGAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969897334_969897338 24 Left 969897334 4:10317610-10317632 CCAGACACTCCTTTCATGCCTGG No data
Right 969897338 4:10317657-10317679 TTATTTGACCCATGCTCACATGG No data
969897334_969897339 29 Left 969897334 4:10317610-10317632 CCAGACACTCCTTTCATGCCTGG No data
Right 969897339 4:10317662-10317684 TGACCCATGCTCACATGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969897334 Original CRISPR CCAGGCATGAAAGGAGTGTC TGG (reversed) Intergenic
No off target data available for this crispr