ID: 969898233

View in Genome Browser
Species Human (GRCh38)
Location 4:10324550-10324572
Sequence GGACTTCTTCCTAGGAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969898231_969898233 -5 Left 969898231 4:10324532-10324554 CCAGTCTTGAGCATCTGGGGACT No data
Right 969898233 4:10324550-10324572 GGACTTCTTCCTAGGAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969898233 Original CRISPR GGACTTCTTCCTAGGAGATG TGG Intergenic
No off target data available for this crispr