ID: 969901171

View in Genome Browser
Species Human (GRCh38)
Location 4:10351098-10351120
Sequence TCTTATATGGAGAAAATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969901171_969901173 17 Left 969901171 4:10351098-10351120 CCTTAAATTTTCTCCATATAAGA No data
Right 969901173 4:10351138-10351160 TAAAGTTGAACTTCCCGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969901171 Original CRISPR TCTTATATGGAGAAAATTTA AGG (reversed) Intergenic
No off target data available for this crispr