ID: 969911566

View in Genome Browser
Species Human (GRCh38)
Location 4:10451928-10451950
Sequence ATGTGAAAAGGAAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 755
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 693}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969911561_969911566 14 Left 969911561 4:10451891-10451913 CCTGTAGCAAATGAATGTGTTTC 0: 1
1: 0
2: 0
3: 11
4: 159
Right 969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG 0: 1
1: 0
2: 4
3: 57
4: 693
969911560_969911566 15 Left 969911560 4:10451890-10451912 CCCTGTAGCAAATGAATGTGTTT 0: 1
1: 0
2: 1
3: 26
4: 313
Right 969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG 0: 1
1: 0
2: 4
3: 57
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969911566 Original CRISPR ATGTGAAAAGGAAAGGTGGG TGG Intronic
900151562 1:1181204-1181226 CTGTGAGATGGACAGGTGGGTGG - Intronic
900423139 1:2564366-2564388 AGGTGACAAGGAAAGGAGAGGGG - Intronic
900861523 1:5236076-5236098 AGTTCTAAAGGAAAGGTGGGGGG + Intergenic
901283351 1:8057012-8057034 ATGTGACAAGGCCAGGTGGCTGG - Intergenic
901303171 1:8214401-8214423 ATATGTAAAGGGAATGTGGGCGG - Intergenic
901386038 1:8909915-8909937 ATCTGGAGAGGAGAGGTGGGCGG + Intergenic
901485327 1:9556153-9556175 ATGTGAAAAGGCAAAGCAGGAGG - Intronic
902370744 1:16005379-16005401 ATGGGAACAGCAAAGTTGGGAGG + Intronic
902891366 1:19446386-19446408 ATGTAAGAAGTAAAGGTGAGTGG + Intronic
903195828 1:21687458-21687480 GTGTGAAGAGGAAAGGCAGGGGG + Intronic
903495321 1:23762568-23762590 ATGTGAAAGGCTGAGGTGGGAGG + Intergenic
904017222 1:27431384-27431406 TTTAGAACAGGAAAGGTGGGAGG + Intronic
904344425 1:29858642-29858664 ATGTGAAAAGGACAGGGTAGAGG + Intergenic
906045265 1:42825308-42825330 ATTTGAAAAGTAAAGGGGGAAGG + Intronic
906790987 1:48658709-48658731 AGGTGAAGAAGAGAGGTGGGAGG + Intronic
906800830 1:48735539-48735561 AAGGAAAAAGGAAAGGAGGGAGG + Intronic
906856283 1:49308727-49308749 ATGAGAAAAGGCAGGGTGGAAGG + Intronic
906921101 1:50065131-50065153 AGGTGAGAGGAAAAGGTGGGGGG - Intronic
907277805 1:53326818-53326840 GAGAGAAAAGGAACGGTGGGGGG - Intronic
907645739 1:56241536-56241558 ATGTTAAAAGGAGTGGTGAGAGG - Intergenic
908769944 1:67586903-67586925 ATGGGAACAGGAAACGAGGGAGG - Intergenic
909052982 1:70789782-70789804 AAGACCAAAGGAAAGGTGGGAGG + Intergenic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910292617 1:85614190-85614212 GAGTGAAAAGGCAAGGTGGAGGG - Intergenic
910984287 1:92990497-92990519 CTTTGGGAAGGAAAGGTGGGAGG + Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
912782426 1:112564217-112564239 AAGGGAAAAGGAAAGGAGGCTGG + Intronic
913372339 1:118114963-118114985 ATATGAAAAGGACAGTTGGGGGG - Intronic
914289067 1:146256082-146256104 TTGTGAGAATGAAAGGTGGAGGG - Intergenic
914550102 1:148706825-148706847 TTGTGAGAATGAAAGGTGGAGGG - Intergenic
914740865 1:150463897-150463919 CTTTGAAAAGCCAAGGTGGGAGG + Intronic
914745333 1:150497286-150497308 AAGAGAAAAAAAAAGGTGGGGGG + Intronic
915122253 1:153636898-153636920 ATGTGAAAAGGAAGAGTGTTAGG - Intronic
915215677 1:154339234-154339256 GTGTGAAGAGGAGAGTTGGGAGG + Intronic
915837273 1:159187915-159187937 ATGAGAGAAGGAAAGGGGGCTGG - Intronic
916261239 1:162844441-162844463 AAGTTAAAAGGGAAGGAGGGAGG - Intronic
916706102 1:167351819-167351841 AGGAGAAAAGAAGAGGTGGGAGG - Intronic
917304251 1:173610621-173610643 AGGTGAGAAGGGAAGGAGGGGGG + Intronic
917367421 1:174247687-174247709 ATATGAAAAGCTAGGGTGGGAGG + Intronic
917733530 1:177899825-177899847 ATATGAAAAGGAACAGTGGAAGG + Intergenic
918472418 1:184887549-184887571 AGGAGAAAAGGAAAGGAGGAGGG - Intronic
919096797 1:193046909-193046931 ATATGAACAGAAAATGTGGGAGG + Intronic
919311972 1:195922125-195922147 ATGAGAAAAGGAAAATGGGGTGG + Intergenic
920499120 1:206475191-206475213 CTGTGAAAACAAAATGTGGGAGG + Intronic
920602991 1:207347727-207347749 ATTTGAGAATGGAAGGTGGGAGG - Intronic
920685974 1:208109265-208109287 AGGTAAAAAGGAAAGGAGAGAGG - Intronic
921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG + Intronic
921682965 1:218056042-218056064 ATTTGAGAAGCTAAGGTGGGAGG - Intergenic
921789011 1:219268246-219268268 AGGTGATAAGGAGGGGTGGGGGG + Intergenic
921833971 1:219759158-219759180 AGGAAAAAAGGAAAGGAGGGAGG + Intronic
921837719 1:219795129-219795151 AGGTGAAAAGCAGGGGTGGGGGG - Intronic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
922168438 1:223135167-223135189 GGTTGAGAAGGAAAGGTGGGGGG + Intronic
922201656 1:223407880-223407902 TTTTGAAAAAGAAAAGTGGGAGG + Intergenic
922465623 1:225844248-225844270 GTGTGTAGAGGCAAGGTGGGTGG + Intronic
922889905 1:229053829-229053851 ATGTGGAAATGGAAGCTGGGAGG - Intergenic
923693180 1:236217417-236217439 CAGTGAAAAGAAAAGGTGAGGGG + Exonic
923777103 1:236989269-236989291 CTTTGGAAAGCAAAGGTGGGAGG + Intergenic
923935340 1:238753673-238753695 ATGTGAAAAGGAAATGATGGGGG + Intergenic
924815828 1:247441195-247441217 AGGGGAAAGGGAAAGGGGGGGGG - Intronic
924927075 1:248693396-248693418 AGGGGGAAAGGACAGGTGGGTGG - Intergenic
1062919489 10:1269128-1269150 GTATGAAAAGGAAAGGAGGAAGG - Intronic
1063228138 10:4035177-4035199 ATTTAAAAGGGAAAAGTGGGAGG - Intergenic
1063232410 10:4078247-4078269 AAAAGGAAAGGAAAGGTGGGGGG + Intergenic
1064101675 10:12469311-12469333 ATATGAAAAGGGGAGGGGGGCGG - Intronic
1064393413 10:14960326-14960348 AAGTGAAAAGGGAATTTGGGTGG + Intronic
1065478289 10:26164773-26164795 ATGAGAGTAGGAAAGGTGCGGGG + Intronic
1065593640 10:27291117-27291139 AAGAGAAAAGGAAAGAGGGGAGG - Intergenic
1065634061 10:27712499-27712521 AGGTAAAAGGAAAAGGTGGGAGG + Intronic
1065931960 10:30487838-30487860 CTTTGGAAAGGAAAGGTGGCAGG - Intergenic
1066368869 10:34802860-34802882 ATGTGAAAAGGTATTGTAGGAGG - Intronic
1066388876 10:34963029-34963051 ATGTGACAACAGAAGGTGGGAGG + Intergenic
1066654243 10:37684135-37684157 AAGTGCAAATGCAAGGTGGGAGG + Intergenic
1067238855 10:44473472-44473494 ATTTAAAAAGAACAGGTGGGAGG - Intergenic
1067964296 10:50891428-50891450 AAGGAACAAGGAAAGGTGGGAGG - Intergenic
1068934675 10:62624037-62624059 ATGTTAAATGGAAAGGAGAGAGG - Intronic
1069016634 10:63436903-63436925 ATGTGAAAAAGAAAAATAGGAGG - Intronic
1069563794 10:69450172-69450194 CTGAGAAAAGGCCAGGTGGGAGG + Intergenic
1070085719 10:73235354-73235376 TTGGGGAAAGAAAAGGTGGGGGG + Intronic
1070326095 10:75390248-75390270 AGGAGAAAAGCAAAGCTGGGTGG - Intergenic
1070354779 10:75629176-75629198 ATCTGAGAAGAAAAGCTGGGAGG + Intronic
1070383266 10:75900778-75900800 AAAAGAAAAAGAAAGGTGGGGGG - Intronic
1070780207 10:79133176-79133198 ATGTGAAAAGGCAGGGAGGTAGG - Intronic
1071166313 10:82811543-82811565 AGGTGAAAAGTAAAGGTGACAGG + Intronic
1071380906 10:85058512-85058534 ATGGGAGAGGGAAAGTTGGGAGG + Intergenic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1071590557 10:86868684-86868706 AAGTGAAAATCAACGGTGGGGGG + Intronic
1074284049 10:112081148-112081170 AAGAGAAAAGGAAAGGAGGAAGG + Intergenic
1074390404 10:113052835-113052857 ATGTCTAATAGAAAGGTGGGAGG - Intronic
1074403738 10:113163501-113163523 ATGGGAGAAGGAAAGGAGGTGGG - Intronic
1074865632 10:117543081-117543103 AAGGAAAAAGGAAAGGAGGGGGG - Exonic
1074961767 10:118452475-118452497 AGGAAAAAAGGAAAGGAGGGAGG + Intergenic
1075051289 10:119184096-119184118 ATGGGGAAGGGAGAGGTGGGCGG - Intergenic
1075307962 10:121384644-121384666 ATCTCAAAAAAAAAGGTGGGGGG - Intergenic
1075651122 10:124128834-124128856 AGGTGCAAAGGGAAGGAGGGAGG + Intergenic
1075902023 10:126050846-126050868 ATGAGAAAAGGAGAGGTGCAAGG - Intronic
1076241636 10:128912999-128913021 ATGTTACAAGGACAGGTGTGAGG - Intergenic
1076602486 10:131667803-131667825 ATGTGAAAAGCAAAGTTGGAGGG - Intergenic
1077747711 11:4925605-4925627 TGGTGAAAAGGAAAGATGGGGGG + Intronic
1077848754 11:6053690-6053712 AGGAGAAAAGGAAAGAGGGGAGG + Intergenic
1078106796 11:8362917-8362939 AGGAAAAAAGGAAAGGAGGGAGG - Intergenic
1078160957 11:8839477-8839499 AACTGAACAAGAAAGGTGGGCGG + Intronic
1078572989 11:12475531-12475553 AGGAGGAAAGGAAGGGTGGGTGG + Intronic
1078573838 11:12482328-12482350 ATTTAAAAAGGAAAGCTGGCCGG + Intronic
1079289281 11:19172702-19172724 ATCTGAAAAAGAAGGGTGGAAGG - Exonic
1079621951 11:22566514-22566536 TGGTGACAAGGAAAGGTGGCAGG + Intergenic
1080438443 11:32268202-32268224 AAAGGAAGAGGAAAGGTGGGTGG + Intergenic
1080634331 11:34110301-34110323 ATGAGCAAAGAAAAGGAGGGAGG - Intronic
1080992073 11:37548737-37548759 ATGTTAAAAGGTAAAATGGGAGG - Intergenic
1081260794 11:40957903-40957925 ATTTGAATTGGAAAGGGGGGAGG - Intronic
1081280983 11:41209035-41209057 ATTTGAAGGGGAAAGGTGGGAGG + Intronic
1081613706 11:44578432-44578454 AGGTGAGAAGGAAAGGTGCTAGG - Intronic
1081675664 11:44967574-44967596 TTGGGAAAAGGAGAGTTGGGTGG - Intergenic
1082189961 11:49231181-49231203 ATGAAGAAAGGAATGGTGGGAGG + Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082766627 11:57173733-57173755 ATATGAAAAGGAAATGGGGCTGG - Intergenic
1082985243 11:59163293-59163315 AGGAGAAAGGGAGAGGTGGGGGG + Intergenic
1083751717 11:64764551-64764573 ATGTGAAAAGAAAAACCGGGCGG + Intergenic
1085095322 11:73755756-73755778 ATGGGAAGAGGAAAGGAGGAAGG + Intronic
1085568139 11:77534148-77534170 ATGAGAAAAGGAAATGAGGGAGG - Intronic
1085750312 11:79155646-79155668 AGGTAAAAAGGAAGGGAGGGAGG - Intronic
1085772893 11:79340596-79340618 ATGAGAGAAGGAATGATGGGCGG - Intronic
1086008283 11:82066701-82066723 ATGTCAAAAGGAAAGGGATGGGG + Intergenic
1086143624 11:83526361-83526383 CTGTGGGAAGGAAAGGTTGGAGG - Intronic
1086676567 11:89615361-89615383 ATGAAGAAAGGAATGGTGGGAGG - Intergenic
1087542577 11:99539588-99539610 ATGTGAAAAGGAAAGATAATTGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088898783 11:114098834-114098856 AGGGGAAAAGGAAATGGGGGAGG + Intronic
1089272443 11:117311375-117311397 GTGGGAATAGGAAAGGTGGCAGG - Intronic
1089357186 11:117861730-117861752 ATGTTAAAAGGAAGGGAAGGGGG - Intronic
1089635300 11:119808027-119808049 ATGGGACAAGGGAAGGAGGGTGG - Intergenic
1089978111 11:122750266-122750288 AAGTAAAGAAGAAAGGTGGGGGG - Intronic
1090273016 11:125401061-125401083 ATGAGAGAAAGAAAGTTGGGTGG + Intronic
1090801989 11:130178808-130178830 GGGTCAAAGGGAAAGGTGGGCGG + Intronic
1090836071 11:130454960-130454982 AGGTGTCAAGGAAAGGTTGGGGG - Intronic
1091155523 11:133368167-133368189 ATGTGAAAGCGAAAGGGAGGGGG + Intronic
1091494922 12:964236-964258 ATGTTGAAAAGAAAGGTGGGGGG + Intronic
1091604602 12:1939419-1939441 TTGTGAAGAGAAAGGGTGGGTGG - Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092075991 12:5673998-5674020 AGATGAAAAGGAGAGGAGGGTGG - Intronic
1092971916 12:13704299-13704321 ATGAGAAAGGGAAAGGATGGAGG + Intronic
1094630401 12:32168461-32168483 ATGGGAAAAGGATGGGAGGGTGG + Intronic
1095397013 12:41772806-41772828 CTGTGGAAAGGAAAGGAGTGTGG + Intergenic
1095923862 12:47558809-47558831 ATGTGAAAAGGAAAAGACTGAGG - Intergenic
1096594971 12:52689259-52689281 ATGTGGGAAGCCAAGGTGGGAGG + Intergenic
1096905815 12:54934359-54934381 ATGTGAAAAGGAAAAGATAGAGG + Intergenic
1098111386 12:67125443-67125465 ATGGGAAAAGCAAGTGTGGGTGG + Intergenic
1098997616 12:77139549-77139571 AAGAGGAAAGGAAAGGAGGGTGG - Intergenic
1099326015 12:81215235-81215257 ATGACAAAAAAAAAGGTGGGGGG - Intronic
1099639393 12:85266463-85266485 ATTTGAAAAGGAAGTGTGAGTGG - Intergenic
1100245359 12:92751906-92751928 ATGTGAAAGGCTGAGGTGGGAGG + Intronic
1100423133 12:94457199-94457221 ACTTGAAAAGGCAAGGTGAGAGG + Intronic
1100601078 12:96111867-96111889 AAGAAAAAAGGAAAGGAGGGAGG - Intergenic
1100666389 12:96758185-96758207 ATCAGAGGAGGAAAGGTGGGAGG + Intronic
1100782703 12:98046503-98046525 ATTTGGGAAGGAGAGGTGGGTGG - Intergenic
1100874682 12:98949559-98949581 ATGTAAAAATGAAAGATCGGTGG + Intronic
1101576472 12:106001799-106001821 CTGTGAAAAGAAAAGGAGTGGGG + Intergenic
1102552540 12:113702197-113702219 AGGAAAAAAGGAAAGGAGGGAGG - Intergenic
1102623618 12:114216788-114216810 ATGAGGAATGGAAAGGAGGGAGG + Intergenic
1102720495 12:115012145-115012167 AGGAGAGAAGAAAAGGTGGGTGG - Intergenic
1104147320 12:126047632-126047654 CTTTGAAAAGCCAAGGTGGGAGG - Intergenic
1105233843 13:18526999-18527021 ATGAGAAAAGGAAGGGAGGGAGG + Intergenic
1105389565 13:19962002-19962024 AATTTAAAAGGATAGGTGGGAGG - Intronic
1105645975 13:22317785-22317807 ATGGCAAAAGGAGAGGTAGGAGG - Intergenic
1105924364 13:24993650-24993672 ATTTGAGAAGGAAGTGTGGGTGG - Intergenic
1106165766 13:27244732-27244754 ATGTGGAAAGGAGACCTGGGAGG + Intergenic
1106947138 13:34841407-34841429 AGGGGAAAAGGAAAGGTAGAAGG + Intergenic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1107348681 13:39490729-39490751 ATTTGAAAAGTAAAGCTGGAGGG + Intronic
1107788757 13:43979885-43979907 ATGTAAAAGGGAAAAGAGGGGGG + Intergenic
1108090922 13:46849106-46849128 CTGGGATAAGGAAAGGTGGGGGG - Intronic
1108252129 13:48577907-48577929 AAGGGAGAAGGAAAGGTGAGAGG - Intergenic
1108340015 13:49489910-49489932 ATGTAAAAAAAAAAGGGGGGGGG - Intronic
1108470072 13:50758693-50758715 ATGTGACAAGGAACTGAGGGAGG - Intronic
1108773056 13:53729100-53729122 ATGTGAAAAGAAAAGCTGACAGG - Intergenic
1108848805 13:54703883-54703905 ATTTGATAAGGAAAAGTGGTGGG - Intergenic
1108927868 13:55775835-55775857 CTCTGAAAAGAAAAGGTGAGGGG - Intergenic
1109263365 13:60169028-60169050 AAGTGGAAAGGCAAGGTGGAGGG - Intergenic
1109510092 13:63360599-63360621 AAGTGAGAGGGAAAGGTGTGTGG + Intergenic
1109585643 13:64398890-64398912 AAGGGAAGAGGGAAGGTGGGGGG + Intergenic
1109986104 13:69987539-69987561 AAGTGAAAAGGAAGGGAGGGTGG + Intronic
1110402900 13:75114921-75114943 ATATGAAAAGCAAAGGAAGGTGG + Intergenic
1110628237 13:77676032-77676054 AGGAGAAAAAGAAAGGAGGGAGG - Intergenic
1111268426 13:85850135-85850157 GTGTGGAAGGGAAATGTGGGTGG - Intergenic
1112569100 13:100577827-100577849 AGGGGAGAAGGAAAGGAGGGAGG + Intronic
1113667792 13:112153065-112153087 ATGGGAAAAGGACAGGTGGTTGG - Intergenic
1114169244 14:20255040-20255062 ATGTGATAACTAAAGGGGGGAGG - Intergenic
1114481186 14:23035818-23035840 ATTTGAAAAATGAAGGTGGGTGG - Intergenic
1114557287 14:23569274-23569296 AGGTCTAAAGAAAAGGTGGGAGG + Exonic
1114565722 14:23631553-23631575 AAGGGAAAAGGAAAGGGGTGGGG - Intronic
1114723843 14:24912394-24912416 TTGTGACAGGGAAAGGTGGCTGG + Intronic
1114758816 14:25288796-25288818 ATGTCAAAAAGCAAGGTTGGAGG + Intergenic
1115496763 14:34012532-34012554 ATGTAAAAAGTAAACGTGGCTGG + Intronic
1116761842 14:49024483-49024505 AAGTGAAAAGAAAACGTGAGGGG - Intergenic
1117478870 14:56123297-56123319 ATGAGAAAAGGAAAAGTGTTAGG - Intronic
1117784194 14:59265620-59265642 AGGTGAGAAGAAAAGTTGGGGGG + Intronic
1118078782 14:62333605-62333627 ATGAAAAAAGAACAGGTGGGTGG - Intergenic
1118145848 14:63135745-63135767 AGGAGAGAAGGAAAGGAGGGGGG + Intergenic
1118464188 14:66015958-66015980 ATGTGAGAAGGTGAGATGGGGGG - Intergenic
1118851913 14:69590531-69590553 ATGTAAAAAAAAAAAGTGGGGGG - Intergenic
1119016268 14:71059118-71059140 ATGTGAAATGAAAGGGGGGGTGG + Intronic
1119071103 14:71585136-71585158 ATGAGAAAAGGGAGGGAGGGAGG + Intronic
1120285575 14:82496263-82496285 ATGACAAAAAAAAAGGTGGGGGG + Intergenic
1120543312 14:85778297-85778319 TTGTCACAAGGACAGGTGGGTGG + Intergenic
1120624360 14:86805988-86806010 ACTTCAAAAGGAAAGGAGGGAGG + Intergenic
1123067977 14:105627799-105627821 AGGTGAAAAGGGCCGGTGGGGGG - Intergenic
1202937460 14_KI270725v1_random:104408-104430 ATGAGGAAAGGAAGGGAGGGAGG - Intergenic
1124464139 15:29920961-29920983 ATGTGAAATGGACAGATGGATGG + Intronic
1124852508 15:33354302-33354324 ATGTGAGAAATAAAGCTGGGTGG - Intronic
1124997815 15:34740879-34740901 ATGTGCAAAGCAGAGGTGAGAGG + Intergenic
1125137931 15:36366191-36366213 CTGTGAGAAGAAAAAGTGGGAGG + Intergenic
1125280243 15:38035110-38035132 AGATGAAAAGGAAAGGAGGATGG + Intergenic
1125321893 15:38497919-38497941 ATGTAGAAAGGAAGGGCGGGGGG - Intronic
1125755759 15:42063606-42063628 ATGTGGCAAGGAACGGAGGGTGG + Intergenic
1125768569 15:42150669-42150691 ACGTGGAAGGTAAAGGTGGGTGG + Exonic
1126455299 15:48855026-48855048 ATGTGAGAGTGAAGGGTGGGAGG + Intronic
1128055944 15:64700231-64700253 ATGTGAAAAGAAGAGGGGGTTGG - Intronic
1128687021 15:69694380-69694402 TGGTGAAAAGGATAGTTGGGGGG - Intergenic
1128773612 15:70302008-70302030 ACCTGAAAAGGAAAGCTGGAGGG - Intergenic
1129026908 15:72584770-72584792 ATGTTAAAAGTAAAGGATGGTGG + Exonic
1129873741 15:78958625-78958647 AGGTGAAAAGCACAGTTGGGCGG - Intergenic
1129915287 15:79264790-79264812 TTGAAAAAAGGAAAGGAGGGGGG + Intergenic
1130164954 15:81445613-81445635 ATGTTGAAAGCAAAGGTGAGAGG - Intergenic
1130271468 15:82452152-82452174 GTTTAAAAAGGAAGGGTGGGTGG - Intergenic
1130463808 15:84179488-84179510 GTTTAAAAAGGAAGGGTGGGTGG - Intronic
1130488866 15:84415295-84415317 GTTTAAAAAGGAAGGGTGGGTGG + Intergenic
1130500458 15:84494053-84494075 GTTTAAAAAGGAAGGGTGGGTGG + Intergenic
1130826772 15:87556966-87556988 AGCTGAAAAGGAAAGGCTGGGGG - Intergenic
1131012056 15:89026368-89026390 ATGTGGCAAGGAACTGTGGGTGG - Intergenic
1131311069 15:91290274-91290296 ATGTGAAGAGGTAAGGAAGGTGG + Intronic
1131336435 15:91553621-91553643 GGGTGATTAGGAAAGGTGGGGGG + Intergenic
1131388713 15:92029736-92029758 TTGTCAAAAGGAAAGGTGAATGG + Intronic
1131408551 15:92186604-92186626 CTGTGAAAAGGAAAACTAGGAGG - Intergenic
1131527379 15:93163341-93163363 ATGTGCAAAGGAAAGGTTCAAGG - Intergenic
1131746174 15:95450333-95450355 ATTTGAATAGCAAAGGAGGGAGG + Intergenic
1131870504 15:96758623-96758645 TTGGGGAAAGAAAAGGTGGGGGG + Intergenic
1132471056 16:103382-103404 CTTTGAAAAGCCAAGGTGGGAGG - Intronic
1133479586 16:6156946-6156968 ACTTGAGAAGCAAAGGTGGGAGG - Intronic
1134024925 16:10946250-10946272 CTGTGGAAAGGATTGGTGGGAGG + Intronic
1134107087 16:11492942-11492964 ATGTGAAAAAGAAAGGCCTGGGG + Intronic
1134313042 16:13093540-13093562 ATGTGCATATGAGAGGTGGGGGG + Intronic
1134659218 16:15971248-15971270 ATATTAAAAGGCTAGGTGGGAGG - Intronic
1135199940 16:20428581-20428603 ATGTGATTAGGAAAGATGAGAGG - Intronic
1135714017 16:24745371-24745393 ATGAGAAAAGGAATGGGGGGTGG + Intronic
1136024014 16:27458471-27458493 ATGGGAAGAGGGAAAGTGGGAGG + Intergenic
1136096990 16:27963750-27963772 ATGTGCAAAGCCATGGTGGGAGG - Intronic
1136128536 16:28203325-28203347 AGGGGGAAAGGAGAGGTGGGAGG + Intronic
1136381330 16:29897249-29897271 GTGGGGAAGGGAAAGGTGGGGGG - Intronic
1137615130 16:49841843-49841865 ATGTGAAAGGGAAAGAAGGAGGG + Intronic
1137922380 16:52503526-52503548 ATGAGCAAATGAAAGGAGGGAGG + Intronic
1138231723 16:55342448-55342470 CTGTGGAAAGCCAAGGTGGGAGG + Intergenic
1138458535 16:57134612-57134634 AGGTGAAAAGCAGATGTGGGGGG + Intronic
1139097815 16:63726943-63726965 AAGTTAAAAGGAAGGGAGGGAGG - Intergenic
1139597159 16:67964739-67964761 ATGTAAACAGAAAAGGTTGGCGG - Intronic
1140134661 16:72195315-72195337 CTGTGAAAAGGAGAGGGGGAAGG - Intergenic
1140213612 16:72990068-72990090 ATTTGAACAGAAACGGTGGGGGG - Intronic
1140339313 16:74141437-74141459 ATCTCAAAAGGAAGGGAGGGAGG + Intergenic
1140517407 16:75553978-75554000 ATGTGATAGGGGATGGTGGGAGG - Intronic
1140678947 16:77364860-77364882 ATTTGAGACGCAAAGGTGGGTGG + Intronic
1140771217 16:78205768-78205790 ATGGGTGAAGGATAGGTGGGTGG - Intronic
1141641558 16:85344484-85344506 ATGTGTAGAGGACAGGTGTGCGG + Intergenic
1141857398 16:86693012-86693034 ATCTGAAAATGAACGGTGGGTGG - Intergenic
1142548928 17:725793-725815 ATTTGAGGAGGCAAGGTGGGAGG + Intergenic
1142771214 17:2098371-2098393 ATGTGAAAGGGAATAGTTGGTGG - Intronic
1143028719 17:3955541-3955563 AGGCGAACAGGAAAGGCGGGGGG + Intronic
1143412012 17:6714611-6714633 AAGGGAAAAGGACAGGAGGGAGG - Intergenic
1144059393 17:11568900-11568922 ATGGCAAAAGGAAAGGGGGGTGG - Intergenic
1145289644 17:21533122-21533144 ATATGAAAGAGAAAGGTGTGGGG + Exonic
1145709075 17:26952272-26952294 ATGAGAGAAGGAAGGGAGGGAGG + Intergenic
1145882437 17:28362297-28362319 CTGTGAAAAGAAAAAGTAGGTGG + Exonic
1146299349 17:31676180-31676202 AGGGAAAAAGGAAAGGAGGGAGG + Intergenic
1146394670 17:32454705-32454727 ATGTGGAAGGGAAAACTGGGAGG + Intronic
1146806048 17:35865773-35865795 AAATGAAAAGGCAAGGTGTGGGG + Intronic
1147491164 17:40867416-40867438 ATATGAAAAAGAAAGCTGGGTGG + Intergenic
1148377065 17:47158194-47158216 ATGTGAAATAGGTAGGTGGGTGG - Exonic
1148564038 17:48622731-48622753 AAGGGCAAAGGAAAGGAGGGAGG + Exonic
1148798253 17:50207860-50207882 ATGGGAAAAGGATAGGAGGCAGG + Intergenic
1148811078 17:50291740-50291762 CTGTGTAAAGGAATGGTGGTGGG - Intergenic
1149024054 17:52003774-52003796 AAGTCAACAGGACAGGTGGGAGG - Intronic
1149184957 17:53986513-53986535 TTGTAAAAGGGAAAGGAGGGAGG - Intergenic
1149451782 17:56755310-56755332 ATGTTAAAAAAAAAGGGGGGGGG + Intergenic
1150028795 17:61708896-61708918 AGCTGAAAAGAAAAGGGGGGTGG + Intronic
1150221852 17:63500080-63500102 ATGTTAAAAGCCAGGGTGGGTGG - Intronic
1150485203 17:65538351-65538373 ACGTGGAAAGGAAAGGGAGGAGG + Intronic
1151145686 17:72038580-72038602 ATGTGGCAAGGAAATGAGGGTGG + Intergenic
1151407137 17:73895753-73895775 AAGTGAGAAGGAAAGAGGGGTGG + Intergenic
1151623194 17:75259904-75259926 CTTTGTAAGGGAAAGGTGGGAGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1153243898 18:3055054-3055076 CTTTGAGAAGGCAAGGTGGGAGG + Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154247659 18:12713992-12714014 ATTTGAAAGGCCAAGGTGGGTGG - Intronic
1154286279 18:13060001-13060023 ATGTGAGAGGGAGAGATGGGAGG + Intronic
1154519174 18:15208452-15208474 ATGAGAGAAGGAAGGGAGGGAGG - Intergenic
1155162921 18:23210022-23210044 GTGTGAAAAAGAAAGCTGGACGG + Intronic
1155389020 18:25313439-25313461 ATATGAAAGGGAAAGGGGAGGGG + Intronic
1155495919 18:26441607-26441629 ATTTTAAAATGAAAGCTGGGGGG + Intergenic
1155809365 18:30212116-30212138 GTGGGAAAAGGCAGGGTGGGGGG + Intergenic
1155884835 18:31195332-31195354 AGGTTAAAAGGAAAGGAGGATGG + Intergenic
1157543188 18:48526872-48526894 AGGTGAAATGGGAAGATGGGAGG + Intergenic
1157738657 18:50072967-50072989 TTGTGGAAAGGTATGGTGGGAGG + Intronic
1157797794 18:50591341-50591363 ATGTAGAATGAAAAGGTGGGAGG - Intronic
1158275136 18:55758639-55758661 ATGTGAAAAGCAAAAGAGAGGGG + Intergenic
1158358899 18:56650066-56650088 ATGTGGTAAGGAACTGTGGGTGG + Intronic
1158414172 18:57234660-57234682 ATGAGGAAAAGAAAGGTGGGAGG + Intergenic
1160123631 18:76151451-76151473 ATGGGGAAAGGGAAGGTGTGAGG - Intergenic
1160398548 18:78590608-78590630 AGCTGGAAAGGAAGGGTGGGAGG - Intergenic
1161030007 19:2053440-2053462 CTTTGAAAAGCCAAGGTGGGAGG - Intergenic
1161174584 19:2833519-2833541 ATGGGAAAAAGAGAGATGGGTGG - Intronic
1161473260 19:4471978-4472000 AGGTGAAAGGGAAAGGTGGGAGG - Intergenic
1161619776 19:5291965-5291987 ATGTGAAAGGGTATGCTGGGTGG - Intronic
1161656334 19:5517799-5517821 CTGTACAAAGGAAAGGTGGCCGG + Intergenic
1162239548 19:9338534-9338556 ATTTGAAGAGGAAAGGATGGTGG + Exonic
1162275456 19:9650478-9650500 ATGTGAAAAGAGAAGGGGGCGGG + Intronic
1162624529 19:11874079-11874101 GTGTGAAAAGGAGATGGGGGTGG - Intronic
1164794455 19:31014807-31014829 ATGGGAAAAGGGAGGGAGGGAGG + Intergenic
1165051904 19:33147239-33147261 AAAAGAAAAGGAAAGGCGGGGGG + Intronic
1165115078 19:33523708-33523730 ATGTCAAAAGAAATGGTGGGAGG - Intergenic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1166401745 19:42486548-42486570 ATTTGAAAGGCCAAGGTGGGAGG - Intergenic
1166462848 19:43004566-43004588 AAGTGAAAGGGAAAGGCAGGAGG + Intronic
1166565966 19:43765680-43765702 ATGTGAAACGGGTATGTGGGTGG + Intergenic
1166760015 19:45218355-45218377 AAGTGAAGAGGGAGGGTGGGAGG - Intronic
1167098960 19:47392249-47392271 ATGACCAAAGGCAAGGTGGGTGG - Intergenic
1167146716 19:47685227-47685249 CTGTGAGAAGCCAAGGTGGGAGG - Intronic
1167217812 19:48176533-48176555 AAGTGAGAAAGAAAGGCGGGAGG - Intronic
1167757718 19:51422849-51422871 ACTTGAAAAGGAAAGGACGGAGG - Intergenic
925222952 2:2157448-2157470 AGGGGAAAAGCAGAGGTGGGAGG + Intronic
925340117 2:3130381-3130403 ATGTGGAAGGGAGAGGCGGGAGG - Intergenic
925856313 2:8133056-8133078 ATGGGAAAGGGAGAGGTGAGAGG - Intergenic
925901180 2:8510567-8510589 ATGTGGACATGAAAGATGGGAGG + Intergenic
925989866 2:9246010-9246032 CTGTGAAAAGGACAGGAGGGTGG + Intronic
926800787 2:16658716-16658738 AAGAGAAAAGGAAGGGTGGAAGG - Intronic
927365215 2:22287180-22287202 ATGGGAAAAAGAAGGGAGGGAGG + Intergenic
927409529 2:22808286-22808308 ATGTGGTAAGGAACTGTGGGTGG + Intergenic
928098878 2:28423312-28423334 AGGTGTGCAGGAAAGGTGGGCGG + Intergenic
928352520 2:30573164-30573186 ATGTGAAAAGCAGAGGGGGGCGG - Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929066369 2:37979209-37979231 GTGTGAAAACGAAGGGTGGAGGG + Intronic
929098161 2:38283551-38283573 ATGTTAAAAGGATAGGAAGGAGG - Intergenic
929546275 2:42857016-42857038 CTGTGAAAAGGAAAAATGAGTGG - Intergenic
929670321 2:43872129-43872151 GTGTGGAAAGGTAAGGTGGCAGG + Exonic
929905446 2:46042118-46042140 ATGTGAAAAGGAAAAGTCAAAGG + Intronic
930288514 2:49465326-49465348 AAGGGAAAGGGAAAGGGGGGAGG - Intergenic
930376689 2:50576019-50576041 ATGTGAAAAAGACAGCAGGGAGG + Intronic
930982788 2:57547807-57547829 AGGAGAGAAGGAAAGGCGGGAGG + Intergenic
931075570 2:58707727-58707749 AAGGGAAAAGGAAAGAAGGGGGG - Intergenic
931934787 2:67185328-67185350 ATGTGAAAAGAAAATGGGGGAGG - Intergenic
932173782 2:69580645-69580667 ATGTGAAAAAGACAAGTTGGTGG - Intronic
932202405 2:69842910-69842932 ATTTGAAAATGGAAGGTGGGGGG - Intronic
932741444 2:74293939-74293961 ATGTGAAAAGTAAAAGAGCGGGG + Intronic
932750461 2:74368333-74368355 ATGTGAAAATGAAAGGGTAGTGG + Intronic
932963873 2:76447422-76447444 GTGTAAAAAAGAAAGGAGGGAGG - Intergenic
932987928 2:76748923-76748945 ATGAGAAATAGAAAGATGGGTGG + Intronic
933195060 2:79379844-79379866 ATGAGAAAAGGAAGAGAGGGTGG + Intronic
934148757 2:89123717-89123739 ATGTGCCTAGGAAAGGTGAGTGG - Intergenic
934218541 2:90058326-90058348 ATGTGCCTAGGAAAGGTGAGTGG + Intergenic
936115893 2:109702755-109702777 CTGTGAGAAGGAAAGATGTGGGG - Intergenic
936664074 2:114574502-114574524 ATGTGAAGAGGAAAGGTAGCTGG + Intronic
936693414 2:114919901-114919923 ATATGAAAAGGCCAGGTGGAGGG - Intronic
936771070 2:115914371-115914393 ATTTAAAAACAAAAGGTGGGTGG - Intergenic
938671228 2:133588514-133588536 ATGGGAAAAGGAAATGAGGCAGG - Intergenic
938877988 2:135553931-135553953 CTTTGAGAAGGCAAGGTGGGCGG - Intronic
939171040 2:138695903-138695925 TTGTGAGAAGGTGAGGTGGGAGG + Intronic
939306084 2:140414157-140414179 CTTTGAAAGGTAAAGGTGGGAGG - Intronic
939747787 2:145998880-145998902 ATGTGAAAAGGAAAAACTGGAGG + Intergenic
939971694 2:148669431-148669453 CTTTGAAAGGGCAAGGTGGGAGG + Intronic
940696802 2:156989912-156989934 AAGTGAAATGGAATGGTGAGTGG + Intergenic
940701615 2:157051402-157051424 ATAGGAAAAGGGAAGGTCGGAGG - Intergenic
942013891 2:171791735-171791757 ATGTGCAAGGGAAATGGGGGAGG + Intronic
942493780 2:176517618-176517640 ATTTGAGAAGGCAAGGTGGGTGG - Intergenic
943007829 2:182408218-182408240 GTGGGAAAATAAAAGGTGGGAGG - Intronic
943212882 2:184990283-184990305 ATGTGAAAAGGAAATGTTGTGGG + Intergenic
943213047 2:184992858-184992880 ATCTGAAAAAGGAAGGTGGTAGG + Intergenic
943915070 2:193621243-193621265 ATGTTAAAATGAAACCTGGGAGG - Intergenic
944349135 2:198706071-198706093 AAGAAAAAAAGAAAGGTGGGAGG + Intergenic
944366063 2:198920665-198920687 CTGAGAAAAAGAAAGCTGGGAGG + Intergenic
944509597 2:200451618-200451640 ATGTGAAAAGGGGAGGGGAGGGG - Intronic
945541844 2:211097654-211097676 CTTTGAAAAGCCAAGGTGGGTGG - Intergenic
945743898 2:213697200-213697222 ATTTGAAAGGGAAGAGTGGGTGG + Intronic
946013656 2:216586930-216586952 AAAAGAAAAAGAAAGGTGGGTGG - Intergenic
946306008 2:218857468-218857490 ATGTTTGCAGGAAAGGTGGGGGG + Intergenic
946390372 2:219411875-219411897 GTTTGAAAAGCCAAGGTGGGAGG + Intergenic
946415464 2:219537846-219537868 AGGTGACAAGGAAAGGCTGGCGG + Intronic
947336610 2:229092347-229092369 AAGTGAAAAGCAAAGATGAGAGG + Intronic
947498235 2:230654294-230654316 GTGTGGGAAGGAAAGGCGGGTGG - Intergenic
947683851 2:232062874-232062896 ATGTGAAAAGGAAGGAAGGAAGG - Intronic
948069842 2:235111761-235111783 CTGTGAAAAGGAAAGCTCTGTGG - Intergenic
948089649 2:235282227-235282249 AAGTAAAAAGGAGAGGTAGGTGG - Intergenic
948200523 2:236127021-236127043 TTCTGAACAGGAAAGGTGAGGGG - Exonic
948959913 2:241326503-241326525 TTGAGAAGAGGCAAGGTGGGGGG - Intronic
948959935 2:241326652-241326674 TTGAGAAGAGGCAAGGTGGGGGG - Intronic
949001295 2:241615747-241615769 GAGTGAAGAGGAGAGGTGGGAGG - Intronic
1168961878 20:1875645-1875667 ATGAGCAAAGGTAAGGAGGGAGG - Intergenic
1169338540 20:4777313-4777335 TTTTGAAAGGGTAAGGTGGGTGG - Intergenic
1169541628 20:6606108-6606130 AAGGGAAAAGGGAAGGAGGGCGG - Intergenic
1169873495 20:10271864-10271886 CTGTGAAAAGGAAAGGTCAATGG + Intronic
1169934422 20:10867388-10867410 ATGGTAAGAGGATAGGTGGGTGG - Intergenic
1170903141 20:20485730-20485752 ATGTTATAAGGATAGGAGGGAGG - Intronic
1171092304 20:22296709-22296731 ATCTGAAAAGAAAGGATGGGAGG + Intergenic
1171162545 20:22941238-22941260 ATGCGAAAAGGAAATGAGGGGGG - Intergenic
1171400874 20:24872461-24872483 ATGTTAGAAGGAAAGGGAGGTGG + Intergenic
1171816575 20:29790755-29790777 ATGAGAGAAGGAAAGATGGAGGG - Intergenic
1172187164 20:33038202-33038224 ATGGATAAAGGAAAGTTGGGTGG - Intronic
1172397413 20:34618536-34618558 CTTTGAAAGGCAAAGGTGGGAGG + Intronic
1172554733 20:35831152-35831174 AAATGAGAAGGAAAGGAGGGAGG - Intronic
1174465338 20:50712905-50712927 CTGTGGAAACCAAAGGTGGGGGG + Intergenic
1174625488 20:51911042-51911064 ATTTTAAAAGGAAATGAGGGTGG - Intergenic
1174771181 20:53301948-53301970 CCTTGAAAAGGAAAAGTGGGGGG + Intronic
1175088603 20:56483121-56483143 AGGTAAAAAGGAAAGGAAGGAGG - Intronic
1175149773 20:56924724-56924746 ATGTTAAAAGGGAAAGGGGGGGG + Intergenic
1175289409 20:57865037-57865059 ATGTCAAAAGAAAGGGTGGGGGG - Intergenic
1176777828 21:13155276-13155298 ATGAGAAAAGGAAGGGAGGGAGG + Intergenic
1177648689 21:23933469-23933491 ATGAGGAAAGGAAAGGAGGATGG - Intergenic
1177881214 21:26696978-26697000 AAGAGAAAAGGAAGGTTGGGTGG + Intergenic
1178360321 21:31944080-31944102 ATCTCAAAAAGAAAGGTGGGAGG - Intronic
1178931032 21:36819448-36819470 ATGTGAAAACGAAAGGTCAGAGG - Intronic
1179020536 21:37636570-37636592 ATGTGAGAAGGAGAGCTTGGAGG + Intronic
1179348144 21:40580690-40580712 ATGGGGACAGGAAAGGCGGGTGG + Intronic
1179962287 21:44775011-44775033 CAGTGCAAAGGACAGGTGGGAGG - Intronic
1180148519 21:45935446-45935468 CTTTAAAAAGGAAAGGAGGGAGG - Intronic
1180631202 22:17231272-17231294 ATGAGAAACAGAAAGATGGGAGG - Intergenic
1180729880 22:17973249-17973271 ATGGGGAAAACAAAGGTGGGGGG + Intronic
1182019079 22:27065793-27065815 ACGTTAAATGGAAAGGTGGAGGG + Intergenic
1182520666 22:30882832-30882854 CTGTGAACAGCAAAGGTAGGAGG + Intronic
1182900669 22:33895641-33895663 ATGTGGCAAGGAACTGTGGGTGG - Intronic
1183148072 22:36013780-36013802 GTGTCAAAAAGAAAGGAGGGGGG + Intronic
1183756350 22:39769833-39769855 TTGTGAAAAGGAAAAGTTTGTGG + Intronic
949478882 3:4474501-4474523 ATTTGAAAAAGAAAAGGGGGCGG - Intergenic
949879175 3:8648487-8648509 CTAGGAAAAGGAAAGGTGGAAGG - Intronic
950474525 3:13207151-13207173 AGGTGACAAGGATAGGTGGGTGG - Intergenic
950576004 3:13832399-13832421 CTGTGAGAAGGAAGAGTGGGAGG - Intronic
950616691 3:14165586-14165608 CTGTGAAGAGGAAAGGAGGAAGG + Intronic
951228576 3:20149538-20149560 ATGTGAAAAGGAAGAGTGAAAGG + Intronic
952097756 3:29974249-29974271 AGGTGAAAATGAAAGGTGGTGGG - Intronic
952102495 3:30030990-30031012 ATGTTAAAAGGAAAAAAGGGAGG - Intergenic
952527816 3:34230885-34230907 ATCAGAAAAGCCAAGGTGGGTGG + Intergenic
953395738 3:42568234-42568256 AAGAGAAAAGGTAAGGAGGGAGG - Intronic
955215858 3:56984435-56984457 ATGTTACAAGGAAGGGAGGGAGG + Intronic
955911117 3:63861460-63861482 ATGCAAAGAGGACAGGTGGGAGG - Intronic
956075686 3:65502824-65502846 ATGTGAAAAGAAAAGGTGTGTGG + Intronic
956106162 3:65821036-65821058 ATCTGCAAAGGAAAGGGTGGTGG + Intronic
956359927 3:68437085-68437107 ATGTTTAAAAGAAAGCTGGGAGG + Intronic
956738070 3:72254082-72254104 GAGTGAGAAGGCAAGGTGGGTGG - Intergenic
957312838 3:78542099-78542121 AGGTGACAAGCAGAGGTGGGAGG + Intergenic
957456097 3:80448563-80448585 ATGAGAAAACAAAAGCTGGGAGG - Intergenic
957548778 3:81676985-81677007 ATTTGAAAAGGAAAGGTTGTTGG - Intronic
958089602 3:88859201-88859223 ATGTGAAAAATGATGGTGGGTGG - Intergenic
958115305 3:89208480-89208502 AAGAGAAAAAGAAAGGAGGGAGG + Intronic
958476506 3:94590816-94590838 ATATGAGAAAGAAAGGTGGAGGG - Intergenic
958693385 3:97497237-97497259 ATGCGTGAAGGAAAGGTTGGTGG - Intronic
959145183 3:102535493-102535515 ATGAGGAAAGGTAATGTGGGTGG - Intergenic
959161121 3:102725370-102725392 ATGTGAAAACGAGATTTGGGAGG + Intergenic
959245271 3:103859755-103859777 ATGTAAAAAGAACACGTGGGTGG - Intergenic
959844208 3:111014184-111014206 ATGTGAAAGGGAAAGATTAGAGG + Intergenic
960526394 3:118716096-118716118 AAGTGGAAAGGAAATGTGTGTGG - Intergenic
960821148 3:121733632-121733654 ATATGAAAAGGCAAGGAGTGTGG + Intronic
961588282 3:127953968-127953990 AAGTCAAAAGGAAAGCTGGCTGG - Intronic
961624417 3:128251113-128251135 ATATGTAAAGAAAAGATGGGGGG - Intronic
962082820 3:132158528-132158550 CTGTGAAAAAGAAAAGTGGCAGG + Intronic
962922198 3:139960327-139960349 CTCTGAAAGGGAAATGTGGGGGG - Intronic
963235500 3:142952035-142952057 CTGTGAAAAAGAAGGGGGGGGGG + Intronic
963801931 3:149684805-149684827 ATTTGAAAGGCAGAGGTGGGAGG - Intronic
964206769 3:154183682-154183704 ATGTAAAAATAAAAGGTGGGTGG + Intronic
964352285 3:155815072-155815094 ATATGGAAAGGGAAGGTGGTTGG + Intergenic
964703315 3:159592547-159592569 ATGTGCAAAGACAAGGTGGCAGG - Intronic
965926727 3:173989743-173989765 CGGGGAAAAGGAAGGGTGGGAGG - Intronic
965962444 3:174444253-174444275 ATGAGAGAAGGAAAAGTGTGGGG + Intronic
966071757 3:175886319-175886341 ATCTGACAAAGAAATGTGGGCGG - Intergenic
966078159 3:175964411-175964433 AAAAGAAAAGGAAAGGAGGGAGG - Intergenic
966719754 3:183050404-183050426 CTGTGAAAAGGAAAGTCGGCCGG + Intronic
967051823 3:185791962-185791984 ATATGGGAAGGAAAGATGGGAGG + Intronic
967320155 3:188187046-188187068 ATGTGGAGAGGAAAAGTGGAGGG - Intronic
967993422 3:195148925-195148947 AGGGGAAGAGGAAAAGTGGGTGG + Intronic
968931196 4:3580396-3580418 ATGATGAATGGAAAGGTGGGTGG - Intronic
968937230 4:3617586-3617608 AGGTGGGAAGGAAAGGAGGGAGG - Intergenic
969502825 4:7563990-7564012 ATGTGGAAAGCAAAGGAGGAAGG - Intronic
969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG + Intronic
970587197 4:17526066-17526088 ATAGAAAAAGGAAAGGAGGGAGG - Intronic
971124627 4:23739861-23739883 ATGTGACAAGGTGGGGTGGGAGG - Intergenic
971254091 4:24998117-24998139 ATTTGATAAGCCAAGGTGGGAGG - Intergenic
971423204 4:26492367-26492389 AAGAGAAAAAGAAAGGAGGGAGG - Intergenic
971423253 4:26492661-26492683 AAGAGAAAAAGAAAGGAGGGAGG - Intergenic
971822179 4:31571583-31571605 TTGTGAAAATGAAATGTAGGAGG + Intergenic
972087077 4:35231345-35231367 ATGTGAATAGGAATGGTGAAGGG + Intergenic
972609690 4:40645109-40645131 ATGAGAAAATGAAGGGTGGCAGG + Intergenic
972763251 4:42127917-42127939 ATTTGAGAGGCAAAGGTGGGAGG + Intronic
973337998 4:48975806-48975828 AGCTGAAAAGGCAAGGTCGGGGG + Intergenic
974065575 4:57073912-57073934 AAGGGAAGAGGAAAGATGGGAGG + Intronic
974155925 4:58072442-58072464 ATGTGACAAGAAAACGTGGGTGG - Intergenic
974174682 4:58307993-58308015 CTTTGAAAAGGAAAAGTGGTGGG - Intergenic
974700062 4:65431591-65431613 AGGAAAAAAGGAAAGGAGGGAGG - Intronic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
975392870 4:73839636-73839658 AAGTGAAAATGAGGGGTGGGTGG - Intronic
975512055 4:75205108-75205130 GTATGAAAATGAAAGCTGGGAGG - Intergenic
975579405 4:75893051-75893073 ATGGGAAAAGAGAAGCTGGGAGG + Intronic
975694479 4:76998280-76998302 CTGTGAAATGGAAATGGGGGTGG - Intronic
975855695 4:78622058-78622080 AAGTGAAATGGAGAGGTAGGAGG + Intergenic
976639986 4:87328052-87328074 ATTTGAAAGGCCAAGGTGGGTGG + Intergenic
977171814 4:93771702-93771724 ATGTATAAAGAAGAGGTGGGGGG + Intronic
977474461 4:97488029-97488051 GTGGGAAAAGGAAAGAGGGGAGG - Intronic
977884261 4:102238941-102238963 CTTTGAAAAGGAAAAGTGGTGGG - Intergenic
978017061 4:103757554-103757576 ATGTCAGAAGGCAAAGTGGGAGG + Intergenic
978145147 4:105364020-105364042 ATGTGAAAAAGTAAAGGGGGTGG - Intergenic
979014591 4:115417907-115417929 CACTGAAAAGGAAAGGTGGCAGG - Intergenic
979917673 4:126457320-126457342 AAATGAAAAGCAAAGGTAGGTGG + Intergenic
980160601 4:129157326-129157348 GTAGGAAAAGGAAAGTTGGGAGG - Intergenic
980595245 4:134946930-134946952 ATGTGATAAAGAATGGCGGGAGG - Intergenic
980715109 4:136617511-136617533 ATGTAAAGTGGAAAGGTGAGAGG - Intergenic
981023093 4:140049265-140049287 GTTGGAAAAGAAAAGGTGGGAGG + Intronic
982134340 4:152259105-152259127 AGATGAAAACGAATGGTGGGAGG - Intergenic
982303459 4:153903802-153903824 ATGGGAAAAGGGAAGGTGGCTGG + Intergenic
982749028 4:159137028-159137050 TTGTAAACAGAAAAGGTGGGGGG + Intronic
983072837 4:163290479-163290501 TTGTGAGAAGCCAAGGTGGGAGG - Intergenic
983162290 4:164431368-164431390 ATGTGAGATGTAAAGGTGTGGGG - Intergenic
983747670 4:171221735-171221757 TTGTGAAAAGGAAAGAAAGGAGG - Intergenic
984449779 4:179884909-179884931 ATGTGTAAAGAAAGGGTGAGAGG - Intergenic
984720806 4:182970901-182970923 AAGGAAAAAGGAAAGGAGGGAGG + Intergenic
985341438 4:188958998-188959020 ATGTGTAAAGCAAGGGTAGGGGG + Intergenic
986106381 5:4663308-4663330 ATGTGAGAAAGAAATGTGTGGGG + Intergenic
986333949 5:6738974-6738996 ATATGAAGAAGACAGGTGGGAGG + Intronic
986475296 5:8123978-8124000 AGAAGAAAAGGAAAGGAGGGAGG + Intergenic
986529695 5:8723435-8723457 GGATGGAAAGGAAAGGTGGGAGG + Intergenic
986868690 5:12020439-12020461 ATGTGAAAAGGAACTGTGGCAGG + Intergenic
987074320 5:14366612-14366634 ATGGGAAATGAAAAGGTGGAGGG - Intronic
987076165 5:14383693-14383715 CTAAGAAAAGGAAAGGTGAGGGG - Intronic
987150485 5:15034583-15034605 ATGTGAGCAGGACAGGAGGGCGG + Intergenic
988424677 5:31049747-31049769 ATGCTAGTAGGAAAGGTGGGAGG - Intergenic
989228245 5:39055419-39055441 ATGTGAAAAAGAGTGGGGGGGGG - Intronic
989334118 5:40294793-40294815 ATGTGAAAAATAAAGGTAGGAGG - Intergenic
990076083 5:51847535-51847557 ACTTGAAAGGGTAAGGTGGGAGG + Intergenic
990291731 5:54359220-54359242 ATATGAAAAGGCAAGGTGAGTGG - Intergenic
990306056 5:54494897-54494919 ATGTGGCAAGGAACTGTGGGTGG - Intergenic
990500836 5:56395624-56395646 ACTTGAGAGGGAAAGGTGGGAGG + Intergenic
990737031 5:58875716-58875738 ATCTGAAAAGGAAAAGTTAGGGG - Intergenic
991154559 5:63416193-63416215 ATGACAATAGCAAAGGTGGGTGG + Intergenic
991510004 5:67365786-67365808 GTGCGAAAAGGCAGGGTGGGGGG + Intergenic
992138260 5:73769293-73769315 ATGTGACTAGGAAAGGAGGAGGG - Intronic
992240157 5:74760665-74760687 CTGAGCAAAGGAAAGGTTGGTGG - Intronic
992262294 5:74983533-74983555 ATCTGTAAAGAAAAGTTGGGGGG - Intergenic
992351917 5:75939032-75939054 ATTTAAACAGGAAAGATGGGAGG + Intergenic
992377557 5:76203327-76203349 ATGGGTAAATGAAGGGTGGGTGG + Intronic
992665893 5:79008719-79008741 AGGGAAACAGGAAAGGTGGGGGG + Intronic
992669219 5:79042185-79042207 ATGCAAAAGGGAAATGTGGGAGG - Intronic
992865894 5:80956870-80956892 ATGAGAAAAGGAAGGAAGGGAGG - Intergenic
993080204 5:83287141-83287163 ATGTGAAAAGGCAGGGTAAGAGG - Intronic
993084499 5:83347685-83347707 ATGTGAGAAGGGGATGTGGGAGG - Intronic
993526652 5:88973639-88973661 AAGAGAAAAGGAAAGATGGAGGG + Intergenic
993552893 5:89296693-89296715 ATGAGCAAAGGAAAGGTGTCAGG + Intergenic
994152589 5:96465432-96465454 ATGTGAAATGGAAGTGTTGGTGG + Intergenic
994231565 5:97314633-97314655 CTTTGAAAAGGAAAAGTGGTGGG + Intergenic
994664460 5:102691041-102691063 ATGGAAAATGGAAAGCTGGGTGG - Intergenic
994731631 5:103498681-103498703 AAGGGAAAAGGAAAGGAGGGAGG + Intergenic
995400637 5:111737096-111737118 ATGTGGAAAAGTAAGGTGGTTGG - Intronic
995580395 5:113594250-113594272 ATGTGACGAGGGAAGGAGGGAGG - Exonic
995718666 5:115106013-115106035 AAAAGAAAAGAAAAGGTGGGAGG + Intergenic
996071602 5:119137463-119137485 ATGTGAAAAGGGGATTTGGGAGG + Intronic
996075906 5:119193542-119193564 ATGTAAAAAGTAAATGAGGGTGG + Intronic
996410582 5:123154712-123154734 ATTTGAAAAGGAAAATTGGAAGG + Intronic
996665702 5:126057437-126057459 CTGTGACAAGGAAAAGAGGGCGG + Intergenic
996821791 5:127637605-127637627 AGGTGAGTATGAAAGGTGGGTGG - Intergenic
996823864 5:127659821-127659843 ATGTGCAAAGGAAAGGAAGAGGG + Intergenic
997370537 5:133356940-133356962 ACCTGAAATGGAAAAGTGGGTGG - Intronic
997406998 5:133657183-133657205 GAGTGGCAAGGAAAGGTGGGAGG - Intergenic
998552668 5:143092547-143092569 TTGAGAAAAAAAAAGGTGGGGGG - Intronic
999320576 5:150612420-150612442 ATGGGAAATGGAAGGATGGGAGG - Intronic
999692690 5:154162385-154162407 AGGAGAAAAGGAAGGGTGGAAGG + Intronic
999855844 5:155592932-155592954 ATGTGCAAAGGAAAACTGGCTGG - Intergenic
999865139 5:155693205-155693227 ATCTGAAAATGAAAGGAGGGAGG - Intergenic
1000200996 5:159011041-159011063 ATTTGAAAAGGAAAGGGAGCAGG - Intronic
1000328424 5:160188995-160189017 ATGTAAAAAGGAAAGAAGGAGGG - Intronic
1000388578 5:160699740-160699762 AGGAGAAAAGGAAAAGGGGGAGG + Intronic
1000780519 5:165474469-165474491 CTGTGTAAAGGAAAGGAGGCAGG + Intergenic
1000797428 5:165682415-165682437 TTGTGGAAAGGGAATGTGGGAGG + Intergenic
1001106502 5:168858913-168858935 ATGTGAAATGCAAAAGTGGGTGG + Intronic
1001117586 5:168952653-168952675 GTGAGAAAAGGAAAAGTGAGAGG + Intronic
1001151795 5:169235947-169235969 ATGTGAAAAGGGAAGGGAGTGGG - Intronic
1001560991 5:172668798-172668820 ATGGGAGAAGGAAAGGCAGGGGG + Intronic
1001742370 5:174064682-174064704 ATGAGAAAAACAAAGGTGGGGGG + Intronic
1001765767 5:174245652-174245674 ACGTGAAAAGCCATGGTGGGGGG - Intergenic
1001770893 5:174295109-174295131 AGGTGAAAAGGAAAAGTTGGGGG - Intergenic
1001802443 5:174555970-174555992 ATGTGCAAAGGCACGGTCGGGGG - Intergenic
1001945581 5:175774987-175775009 ATGTGAACAGGAAATGAGGATGG + Intergenic
1002029976 5:176420765-176420787 ATGTGAAAAGGACAGGGTAGAGG + Intergenic
1002090650 5:176803569-176803591 ATGTGAAAAGGAGGGGGCGGAGG - Intergenic
1003571757 6:7260789-7260811 ATGAGATCAGGAAAGGTGGCCGG + Intergenic
1004031330 6:11871974-11871996 TTGTGAAAAGGAAGGAAGGGAGG - Intergenic
1004458791 6:15816703-15816725 ATGGGTAAAGGAAAGGTGAGGGG + Intergenic
1005440727 6:25864924-25864946 AAGTGAAAAGGAATGGGTGGTGG + Intronic
1005923451 6:30419929-30419951 AACAGAAAAGGAAAGGTTGGGGG + Intergenic
1006728507 6:36217490-36217512 ATCTGAAGAGGCAAGGTGGTTGG + Intronic
1007394605 6:41570395-41570417 GTGAGAGAAGGACAGGTGGGAGG + Intronic
1007671812 6:43561314-43561336 ATGTGAATAGGTAAGGTCTGAGG - Intronic
1007923819 6:45634977-45634999 ATGAGACTAGGAAAGGTGGATGG + Intronic
1008223642 6:48884454-48884476 AAGTGAAAACGAAAAGTGGTGGG + Intergenic
1008626974 6:53326475-53326497 ATGTGAAAAGGAAACGGGTGGGG - Intronic
1008759612 6:54837915-54837937 ATAGGACAAGGAGAGGTGGGAGG + Intergenic
1008760642 6:54847952-54847974 ATGAGAAAGGGAAAGAAGGGAGG - Intronic
1009653385 6:66506318-66506340 ATATGAATAGGAAATGTGGTTGG - Intergenic
1009827678 6:68888093-68888115 ATGTGAAAAGTAAAGGATGAGGG + Intronic
1009830780 6:68929947-68929969 ATGTGATTAGAAAAGGGGGGAGG + Intronic
1009898289 6:69780091-69780113 ATATTAAAAGGCTAGGTGGGAGG + Intronic
1009980177 6:70718419-70718441 ATGTGAAAAAGCAATGTTGGAGG + Intronic
1010050526 6:71498847-71498869 ATGTGAAAAGGTGAGGCAGGAGG + Intergenic
1010148995 6:72708358-72708380 ATGTGAAATGGAAAAGAGGGTGG + Intronic
1010163129 6:72882323-72882345 ATGTTAAAAGTAGATGTGGGTGG + Intronic
1010278045 6:73991464-73991486 ATGTGAAAAGGAACTGAGGAAGG - Intergenic
1010307033 6:74336884-74336906 AAGAAAAAAGGAAAGGAGGGGGG - Intergenic
1010636484 6:78265063-78265085 TGGTGAAAAGGAATGCTGGGAGG + Intergenic
1011214868 6:84994845-84994867 ATGGGAAGAGGAAAGGTGGACGG - Intergenic
1011331619 6:86213779-86213801 ATGTGAAAAGCACAAGTGGCTGG - Intergenic
1011404128 6:86999589-86999611 AGGTGAAAAGGAAAAGATGGTGG - Intronic
1011679390 6:89768247-89768269 TTGTGCAAGGGACAGGTGGGAGG + Intronic
1012264923 6:97130004-97130026 CTGATAAAAGGAAATGTGGGTGG + Intronic
1012676379 6:102118240-102118262 AAGAGAAAAAGAAAGGAGGGAGG + Intergenic
1012961344 6:105625317-105625339 AAGAGAAAAGGGAAGGGGGGGGG + Intergenic
1013650175 6:112186983-112187005 AAATAAGAAGGAAAGGTGGGTGG + Intronic
1013963607 6:115929296-115929318 ATGTGAAGAGGAAGAATGGGAGG + Intergenic
1013977998 6:116098893-116098915 AGGTACAAAGGAAAGGTGAGTGG + Intergenic
1014754898 6:125292097-125292119 ATGTGAAAAGTGAGAGTGGGAGG + Intronic
1015063406 6:128996277-128996299 ATGTGAAAAGGCATGATGGTGGG + Intronic
1015889488 6:137955386-137955408 ATATTAAAAGGCTAGGTGGGAGG - Intergenic
1016553905 6:145313853-145313875 GTGTGAAAAGGACAGGTTGCAGG - Intergenic
1018823748 6:167393870-167393892 ATGTGACAATGAAAGCAGGGAGG + Intergenic
1019229697 6:170549235-170549257 ATGGGAAGAGGAAAGATGAGCGG + Intronic
1020460868 7:8428330-8428352 ATCTGAAAAGGAATGGTTAGTGG + Intergenic
1020508315 7:9020452-9020474 TTGTAAAAGGGAAAGGGGGGAGG + Intergenic
1020621073 7:10519875-10519897 ATGTGGAAAGAAAAGGTGTAAGG + Intergenic
1020835521 7:13145589-13145611 AGGTTAAAAAAAAAGGTGGGGGG - Intergenic
1021656720 7:22880712-22880734 AGGTGAGAAGGAAGGATGGGAGG - Intergenic
1021799547 7:24290535-24290557 AGGTTAGAAGGGAAGGTGGGTGG - Intronic
1022044896 7:26614736-26614758 ATGGGAAGAGAAGAGGTGGGAGG - Intergenic
1022244843 7:28549121-28549143 ATGTGGAATGGAAATGAGGGTGG - Intronic
1022555896 7:31295715-31295737 ATGTTAAAAGTAAGGGTGAGAGG + Intergenic
1022629349 7:32070784-32070806 AGGTGAAAAGGAGGGCTGGGTGG + Intronic
1022730669 7:33020953-33020975 ATGTGTAAAGAAAAGGTATGAGG - Intronic
1022904525 7:34843000-34843022 GTGGGAATAGGAGAGGTGGGAGG - Intronic
1023328914 7:39091974-39091996 ATGTGAAGAGGAAGGGTAGAAGG + Intronic
1023935128 7:44734278-44734300 AGGGGGAAAGGAAAGGTGAGGGG - Intergenic
1026436629 7:70404670-70404692 ATGTGCAGAGGAAATTTGGGGGG + Intronic
1026726493 7:72873984-72874006 GTGGGAAAAGAAAAGGTGAGAGG - Intergenic
1027035951 7:74925422-74925444 AAGTGAAAGGCCAAGGTGGGCGG - Intergenic
1027111637 7:75444244-75444266 ATTTGAAAAAAAAAGGGGGGGGG + Intronic
1027515908 7:79141359-79141381 ATTTGAAAGGGAAAACTGGGAGG - Intronic
1028684536 7:93576434-93576456 ATGTGACTAGGAAAGGAGGCTGG + Intergenic
1029729641 7:102430820-102430842 AAGAGAAAAGGAAGGGAGGGAGG + Intergenic
1030328334 7:108246084-108246106 ATTGGAAAAGGAAAGATGGTTGG + Intronic
1031166708 7:118237666-118237688 ATATGAAAAGCATAGGTGGGAGG + Intronic
1033010799 7:137620427-137620449 ATAGGAAAAGGAAAGGCAGGTGG - Intronic
1033022303 7:137738727-137738749 ATATGAAAAGGAAAGGGGGGGGG - Intronic
1033231571 7:139602462-139602484 ATGTCAAAACGAAAGGAAGGAGG + Intronic
1033360010 7:140632365-140632387 ATGTGGATAAGAAAGGTGGTGGG + Intronic
1033384732 7:140861843-140861865 AAGTAGAAAGGAAAAGTGGGAGG + Intronic
1033842991 7:145397707-145397729 CTTTGGAAAGTAAAGGTGGGAGG - Intergenic
1034184572 7:149164793-149164815 GTGTGAAAAGAAATTGTGGGAGG + Intronic
1034536600 7:151729394-151729416 CTGGCAAAAGGAGAGGTGGGTGG + Intronic
1035179935 7:157081941-157081963 ATGTGAAGAGGAAAGTGGGCTGG + Intergenic
1035415773 7:158684340-158684362 TTAAGAAAAGGAAAGGAGGGAGG + Intronic
1035895107 8:3391125-3391147 ATCAGAAAAGGAAAGGAGAGTGG - Intronic
1036083830 8:5590831-5590853 CTGTGTAAAGGAAGGGTTGGAGG - Intergenic
1037274119 8:17159159-17159181 CTGTGAAAAGGAAAGGAGTCTGG - Intronic
1037364147 8:18104505-18104527 ATGTGAGAAGGACATTTGGGAGG + Intergenic
1037674130 8:21039696-21039718 ATTTGAAAGGGAAAGATGGATGG - Intergenic
1038376574 8:27046099-27046121 TTGTGAAATGGAAAGCTGTGAGG + Intergenic
1039450371 8:37669256-37669278 ATATGAAAAGAAAAGTTGTGTGG + Intergenic
1040667713 8:49653359-49653381 CTGTGATAAGGAAAAGTGGTGGG + Intergenic
1040737614 8:50528708-50528730 ATGTTAAAAGGAATGATGAGCGG - Intronic
1040858491 8:51974569-51974591 ATGTAAAAAGTAAGGCTGGGAGG - Intergenic
1041260096 8:56013799-56013821 ATGCTAAGAGGAAAGCTGGGCGG - Intergenic
1041573938 8:59371116-59371138 AAGGAAAAAGGAAAGGAGGGAGG - Intergenic
1041712778 8:60909122-60909144 GTGGGTAAAGGAAATGTGGGGGG - Intergenic
1041714361 8:60920808-60920830 AAGAGAAAAGGAAAAGTAGGAGG - Intergenic
1043320433 8:78978263-78978285 ATGTTAAAAGGAGTAGTGGGAGG + Intergenic
1043804408 8:84653409-84653431 ATGAGCAAAAGAAAGGTAGGAGG - Intronic
1043880964 8:85542589-85542611 TTGGGAAAAAGACAGGTGGGAGG - Intergenic
1044119335 8:88375524-88375546 AGTTGGAGAGGAAAGGTGGGAGG + Intergenic
1044341550 8:91051647-91051669 AAGGAAATAGGAAAGGTGGGTGG + Intergenic
1044550847 8:93510850-93510872 AAGTAAAATGGAAAGGTGGGGGG - Intergenic
1044728063 8:95208871-95208893 GTGAGAAAAGGAAAGATGGAGGG - Intergenic
1046476118 8:114745946-114745968 AGGTAAAAAGGAAAGAAGGGAGG + Intergenic
1047776273 8:128073378-128073400 GTGTCAAAAGGAAGGGAGGGAGG - Intergenic
1047933320 8:129751606-129751628 ATCTGAAAAGCAAATTTGGGGGG - Intronic
1047957638 8:129987527-129987549 AAAAGAAAAGAAAAGGTGGGAGG - Intronic
1048363846 8:133721128-133721150 ATGGGAAAGGAAGAGGTGGGCGG + Intergenic
1049114847 8:140677184-140677206 TTGTGATAAGGATAGTTGGGAGG - Intronic
1049203293 8:141352032-141352054 GGGTGAGTAGGAAAGGTGGGAGG - Intergenic
1050248909 9:3722916-3722938 ATCTCAAAAAAAAAGGTGGGGGG - Intergenic
1050766540 9:9141572-9141594 ATGTAAAGAGGAAACATGGGTGG - Intronic
1050812817 9:9770826-9770848 ATGAGAAGAGGAAGGGTAGGAGG + Intronic
1051813479 9:21076849-21076871 AAGAGAAAAGGAAAGCTGGAGGG - Intergenic
1052416463 9:28184182-28184204 ATGGGAAAAGGGGAGGTAGGTGG + Intronic
1052632803 9:31062218-31062240 AAGAGATAAGAAAAGGTGGGGGG - Intergenic
1052642346 9:31184989-31185011 ATGGCAAAAGGGAGGGTGGGAGG + Intergenic
1052951019 9:34211704-34211726 ATGGGAAAAGGAAAAGTTGAAGG - Intronic
1053140350 9:35678939-35678961 AGGAGAGAAGGGAAGGTGGGAGG - Intronic
1053211013 9:36228350-36228372 ATTTGAAACAGAAAGGAGGGTGG + Intronic
1054453915 9:65420086-65420108 AGGTGGGAAGGAAAGGAGGGAGG + Intergenic
1054458959 9:65451674-65451696 ATGATGAATGGAAAGGTGGGTGG + Intergenic
1055477598 9:76678380-76678402 AGGAGAAAGGGAAAGGAGGGAGG + Intronic
1055674321 9:78639875-78639897 ATGTGAGAAGCCAAGGCGGGTGG + Intergenic
1055752835 9:79526607-79526629 ATGGGAAGAGGAAAGATGGCAGG + Intergenic
1055779361 9:79802902-79802924 ATGTGAAAAGGAACAGAGGGAGG - Intergenic
1055884740 9:81047884-81047906 ATGTGAAAATGAGATGTAGGAGG + Intergenic
1056939750 9:90945058-90945080 ATAAGCAAAGGAAAGGCGGGTGG + Intergenic
1057093312 9:92280738-92280760 ATGTGAAAATTAAAGGTAAGTGG - Exonic
1057376738 9:94531211-94531233 AAAAGAAAATGAAAGGTGGGTGG + Intergenic
1057485872 9:95483665-95483687 ATGGACAAAGGAAACGTGGGCGG - Intronic
1058718054 9:107739792-107739814 GTTTGCAAAGGAAGGGTGGGGGG + Intergenic
1058916720 9:109574176-109574198 ATTTGAGAATGGAAGGTGGGAGG + Intergenic
1059268448 9:113057489-113057511 AAGAAAAAAGAAAAGGTGGGAGG + Intergenic
1059301442 9:113316895-113316917 AGGTGAAAAGGCAGGCTGGGGGG + Exonic
1059589451 9:115642359-115642381 TTGTGAAAAGAAAAGGAGGTGGG - Intergenic
1059631093 9:116123316-116123338 ATGTAATAAGGAAAGGAGAGAGG - Intergenic
1059739890 9:117139776-117139798 ATGTATAAAGGAAAGCTGGGAGG + Intronic
1059880531 9:118683994-118684016 ATGTTAAAAATATAGGTGGGAGG + Intergenic
1060024540 9:120160183-120160205 ATGAGAAAGGGAAAGTTGGAGGG + Intergenic
1060082598 9:120665154-120665176 AGGTGAGAAGGAAGGATGGGAGG - Intronic
1060471661 9:123952856-123952878 ATGTGAAAAGGCAAGGAGAGGGG - Intergenic
1060690889 9:125659004-125659026 CTTTGGAAAGGCAAGGTGGGAGG + Intronic
1062137816 9:134938956-134938978 AGGTGAAATGGACAGGTGTGTGG - Intergenic
1185611145 X:1394371-1394393 AAGTGAAAAGGAAGGCGGGGAGG - Intergenic
1185956209 X:4493727-4493749 TTGGGAAAAGGAAAGGCAGGAGG - Intergenic
1186264579 X:7818602-7818624 AGGAGAAAAGGAAGGGAGGGAGG + Intergenic
1186501034 X:10050662-10050684 ATTTGAACAGGAAAGGGGCGGGG + Intronic
1186607816 X:11110295-11110317 GAGTGAAAAGGAATTGTGGGAGG + Intergenic
1187486775 X:19711598-19711620 ATGTGAAAAAAAGAGGTGGTGGG - Intronic
1187777853 X:22783948-22783970 AAGAGAAAAGAAAAGCTGGGAGG - Intergenic
1188515884 X:30985601-30985623 ACGTTAAAAGGAAAGATGGTGGG - Intergenic
1188597650 X:31921093-31921115 ATGTCAAAAATAAAGGTAGGGGG + Intronic
1188677793 X:32964462-32964484 CTTTGGAAAGCAAAGGTGGGTGG + Intronic
1189375621 X:40464372-40464394 ATGTGAATAGAAAAGATGGATGG + Intergenic
1189700983 X:43716168-43716190 AAGTAAACAGGAAAGGTGGATGG + Intronic
1189865746 X:45325272-45325294 ATGTGAAAAATAAACGTGGGAGG + Intergenic
1190727251 X:53197634-53197656 GTGAGAAAAGAACAGGTGGGAGG - Intronic
1191148207 X:57190858-57190880 ATGTATAAAGAAAATGTGGGGGG - Intergenic
1192434532 X:71134928-71134950 ACGTGAGAAGGAAAGGTAGAGGG - Intronic
1192566371 X:72167384-72167406 ATTTTAAAAGTAGAGGTGGGGGG + Intergenic
1193223642 X:78956278-78956300 AGGTGAAAAGGATAGGTGCAGGG + Intronic
1193239583 X:79151668-79151690 AGGTGAAAAGGAAAAGGAGGCGG + Intergenic
1193350374 X:80456863-80456885 ATGTGCAAGGGAAATGTGTGTGG - Intergenic
1193992353 X:88323605-88323627 ATCAGAAGAGGGAAGGTGGGAGG - Intergenic
1194215025 X:91119528-91119550 TGCTGAAAAGGAAGGGTGGGGGG + Intergenic
1194340818 X:92702807-92702829 ATGTGAAAAGTAAATGTTGGTGG + Intergenic
1195702002 X:107712600-107712622 AAGAGCAAAGGAAAGGGGGGTGG + Intergenic
1195905680 X:109841916-109841938 AAGTGAGAAAGAATGGTGGGAGG - Intergenic
1197513562 X:127398658-127398680 CTTTGATAAGGAAAAGTGGGTGG - Intergenic
1197764014 X:130047743-130047765 ATATGGAGAGGAAAGGAGGGAGG - Intronic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198364580 X:135927997-135928019 ATGGGACAGGGACAGGTGGGTGG + Intergenic
1198507917 X:137319392-137319414 ATGTGAATAGGAAATGAGCGAGG + Intergenic
1199581932 X:149369004-149369026 AAGTGCAGAGCAAAGGTGGGGGG - Intergenic
1199903388 X:152199817-152199839 ATGTGAGACAGAAAGGAGGGAGG - Intronic
1200336123 X:155353379-155353401 ATTTAAAAAAAAAAGGTGGGGGG + Intergenic
1200350347 X:155487848-155487870 ATTTAAAAAAAAAAGGTGGGGGG - Intergenic
1200649170 Y:5819535-5819557 ATGTGAAAAGTAAATGTTGGTGG + Intergenic