ID: 969912257

View in Genome Browser
Species Human (GRCh38)
Location 4:10457365-10457387
Sequence CGCCGGCGGTCTGCGGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 109}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969912257_969912264 4 Left 969912257 4:10457365-10457387 CCGCCGGCCGCAGACCGCCGGCG 0: 1
1: 0
2: 1
3: 18
4: 109
Right 969912264 4:10457392-10457414 GCCCGCTGTAGGTCCCTACCCGG 0: 1
1: 0
2: 0
3: 0
4: 48
969912257_969912271 11 Left 969912257 4:10457365-10457387 CCGCCGGCCGCAGACCGCCGGCG 0: 1
1: 0
2: 1
3: 18
4: 109
Right 969912271 4:10457399-10457421 GTAGGTCCCTACCCGGGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
969912257_969912269 7 Left 969912257 4:10457365-10457387 CCGCCGGCCGCAGACCGCCGGCG 0: 1
1: 0
2: 1
3: 18
4: 109
Right 969912269 4:10457395-10457417 CGCTGTAGGTCCCTACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 27
969912257_969912266 5 Left 969912257 4:10457365-10457387 CCGCCGGCCGCAGACCGCCGGCG 0: 1
1: 0
2: 1
3: 18
4: 109
Right 969912266 4:10457393-10457415 CCCGCTGTAGGTCCCTACCCGGG 0: 1
1: 0
2: 1
3: 6
4: 77
969912257_969912270 8 Left 969912257 4:10457365-10457387 CCGCCGGCCGCAGACCGCCGGCG 0: 1
1: 0
2: 1
3: 18
4: 109
Right 969912270 4:10457396-10457418 GCTGTAGGTCCCTACCCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 55
969912257_969912261 -7 Left 969912257 4:10457365-10457387 CCGCCGGCCGCAGACCGCCGGCG 0: 1
1: 0
2: 1
3: 18
4: 109
Right 969912261 4:10457381-10457403 GCCGGCGCCGCGCCCGCTGTAGG 0: 1
1: 0
2: 0
3: 16
4: 192
969912257_969912268 6 Left 969912257 4:10457365-10457387 CCGCCGGCCGCAGACCGCCGGCG 0: 1
1: 0
2: 1
3: 18
4: 109
Right 969912268 4:10457394-10457416 CCGCTGTAGGTCCCTACCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969912257 Original CRISPR CGCCGGCGGTCTGCGGCCGG CGG (reversed) Intronic
900003580 1:29388-29410 CGCGGGCGGACTGGGGGCGGCGG - Intergenic
900023300 1:199904-199926 CGCGGGCGGACTGTGGGCGGCGG - Intergenic
900414735 1:2529763-2529785 CGGCGGCGGTGAGCGGGCGGCGG + Intronic
900458634 1:2789675-2789697 CGCCTGCAGGCTGCGGCCCGAGG - Intronic
901109908 1:6785805-6785827 CGGGGGCGGGCTGGGGCCGGAGG + Intronic
903062922 1:20682871-20682893 CGCCGGCAGTCTGCAGCTGTTGG - Exonic
903813052 1:26045618-26045640 CGCGGGGGGCCTGGGGCCGGGGG - Intronic
903950520 1:26993753-26993775 CACCGGCGGTCTGCGGCTGTAGG - Exonic
923141101 1:231162250-231162272 CGCCGGCTGACTGCGCCCTGGGG - Intronic
924560445 1:245154014-245154036 CGCCGGGGGACTGGGGCGGGGGG + Intergenic
1062889670 10:1048872-1048894 CGGCGGTTGTCTGTGGCCGGAGG - Exonic
1069615065 10:69801729-69801751 GGCCGGCGGGCTGGGGCCGCCGG + Intergenic
1075698031 10:124449958-124449980 GGCCGGCGGTCGGCGGCGCGGGG + Exonic
1078266364 11:9758654-9758676 CGCCGCCTGCCTGCGGCCCGCGG + Intergenic
1081666490 11:44919899-44919921 TGCCGGAGGCCTGCTGCCGGAGG + Exonic
1084070142 11:66728414-66728436 AGCCGGCGGCCTGCGGCAGGGGG - Intronic
1084128693 11:67118200-67118222 CGCCGGGCGCCTCCGGCCGGCGG + Intergenic
1084873373 11:72112652-72112674 CGCCGGGAGGCTGCTGCCGGCGG + Exonic
1090210998 11:124921091-124921113 CGCCCGCGGTCTGCGGCCAGTGG - Exonic
1091376999 12:31442-31464 CGCGGGCGGACTGTGGGCGGCGG - Intergenic
1091750574 12:3019235-3019257 CGCAGGCGTTCGGCTGCCGGGGG - Intronic
1095206159 12:39442889-39442911 CGGCGGCGGGCGGCGGGCGGCGG - Intronic
1099989559 12:89708561-89708583 CGCCGCCCGCCCGCGGCCGGGGG - Intronic
1100315480 12:93441492-93441514 CGCCCGCGGCCTCCGGCGGGGGG + Intronic
1100490436 12:95073254-95073276 GGCCGGCGTCCTGCGGCCAGCGG - Intronic
1101782163 12:107845894-107845916 AGCCGGCGGGATGCGGCTGGCGG - Intergenic
1102116005 12:110403464-110403486 CGGCGGCGGTCTGGGAGCGGGGG - Intronic
1104595971 12:130120172-130120194 CACCGGAGGTCTGCTGCCAGTGG - Intergenic
1107467570 13:40664893-40664915 CGCCGGCGCTCCGCAGGCGGTGG + Intronic
1113775582 13:112943336-112943358 CGCCTGGGCTCTGCGGCCGGGGG - Intronic
1122130860 14:99604043-99604065 CGCGGGCGGGGGGCGGCCGGGGG + Intergenic
1122543372 14:102509716-102509738 CGCCGGCGGCGGGCGGCGGGCGG + Exonic
1122543374 14:102509719-102509741 CGGCGGCGGGCGGCGGGCGGCGG + Exonic
1128109524 15:65067853-65067875 CCACGCAGGTCTGCGGCCGGTGG + Exonic
1130040907 15:80404569-80404591 GGCCTGCGGGCTGCGGCGGGCGG - Intronic
1132449921 15:101961552-101961574 CGCGGGCGGACTGTGGGCGGCGG + Intergenic
1133213118 16:4273827-4273849 CGCTGGCAGCCTGCGCCCGGGGG - Intergenic
1136552235 16:30987904-30987926 CCCCTGCGGACTGCGGCTGGTGG + Exonic
1137707877 16:50548193-50548215 CTGCCGCGGTCTGGGGCCGGGGG - Intergenic
1141839803 16:86567283-86567305 CGCGCACGGACTGCGGCCGGGGG - Exonic
1142336054 16:89490214-89490236 CGCCGCTGGTCTGGGGGCGGTGG - Intronic
1143109541 17:4545497-4545519 TGCCGGGAGCCTGCGGCCGGTGG - Intronic
1146052866 17:29566982-29567004 CCCCGGCGGGCAGCGGGCGGCGG + Exonic
1147591782 17:41688709-41688731 CGCAGGAAGTCTGCGGCAGGAGG - Intergenic
1148936475 17:51167252-51167274 CGCAGGGGGTCTGGGGCCCGGGG - Intronic
1151293206 17:73165086-73165108 CGCCGGGGGTCTGCGGGCGAGGG + Exonic
1153900797 18:9615021-9615043 CGTCGGCGATCCGGGGCCGGGGG + Intronic
1156502020 18:37566138-37566160 CCACGGCGGGCGGCGGCCGGGGG + Intergenic
1160239738 18:77114708-77114730 CGCCCTTGCTCTGCGGCCGGTGG + Intronic
1160635333 19:70995-71017 CGCGGGCGGACTGGGGGCGGCGG - Intergenic
1160689764 19:456175-456197 CACCCGGGGGCTGCGGCCGGCGG - Intronic
1160766850 19:812638-812660 CGCGGGCGGCCTGGGGCTGGCGG - Exonic
1160882056 19:1325367-1325389 CGGCGGGGGGCGGCGGCCGGGGG + Intergenic
1162435274 19:10654423-10654445 CCCCGGCGGGCTGTGGCAGGAGG + Exonic
1163138639 19:15331946-15331968 GGCCGGCGGTCGGGGGCGGGCGG - Intronic
1166000713 19:39875922-39875944 CGCCGTCGACCTGCGGGCGGGGG + Exonic
1166107763 19:40605757-40605779 CGCAGGAGGTCTGCTGCCGAGGG + Exonic
1166984039 19:46649229-46649251 TGGCGGCGGTTTGCGGCGGGCGG + Exonic
1167494449 19:49809413-49809435 CGCGAGCGGTCTGCGGCGGCAGG + Exonic
1168042329 19:53768575-53768597 TGCCGGCTGTCTGCGGGCCGCGG + Intergenic
925090499 2:1151296-1151318 TGCCGGCGGGCTGCCTCCGGGGG + Intronic
926202603 2:10812583-10812605 CCCCGGCGGGCCGCGGCCGCAGG - Intronic
928983226 2:37156934-37156956 AGCCGCGGGTCTCCGGCCGGCGG - Exonic
932490202 2:72115477-72115499 CGCCGAGGGGCTGCGGCTGGAGG - Intergenic
932496708 2:72149102-72149124 CCCGGGCGGGCTGCGGGCGGCGG - Intergenic
936038421 2:109130062-109130084 CGCCGGCAGTCTGCGGGAGCTGG + Exonic
940640752 2:156342370-156342392 CGCCGGGGGCCGGGGGCCGGGGG - Intergenic
947729240 2:232418987-232419009 CGCCCCGGGTCTGCGGCCGCTGG + Intergenic
948492169 2:238320632-238320654 CGCGGGCGGCCAGCGGGCGGCGG + Exonic
1169244578 20:4015545-4015567 CGGCGGCTGACTGCGCCCGGCGG + Intronic
1172015510 20:31870493-31870515 GGCCGGGGGTCGGCGGGCGGTGG - Exonic
1172519148 20:35556149-35556171 GGCCGGCCTTCTGCGGCTGGGGG - Intronic
1173279781 20:41618119-41618141 AGGCGGCGGCCTGCGGCCTGGGG - Intronic
1176550122 21:8217268-8217290 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1176569050 21:8400303-8400325 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1176576964 21:8444538-8444560 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1179186294 21:39087532-39087554 CGCCGGGGGTCTGCTGCCAGCGG + Intergenic
1179674903 21:42974738-42974760 CGGCGGCGGGCGGCGGCCGCGGG - Intronic
1180160520 21:45997010-45997032 GGCAGGTGGTCTGCGGCCTGGGG + Intronic
1183577425 22:38700847-38700869 GCCCTGGGGTCTGCGGCCGGGGG - Intronic
1183585899 22:38752774-38752796 CGCCGGGGGCCGGGGGCCGGGGG - Intronic
1183744890 22:39686418-39686440 GGCGGGCGGTGGGCGGCCGGGGG - Exonic
1203255015 22_KI270733v1_random:133600-133622 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203263071 22_KI270733v1_random:178679-178701 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
953899833 3:46833803-46833825 AGCCTGCGGTCCGCGGCCCGGGG - Intronic
968674899 4:1871838-1871860 GGGCGGCGGCCTGCGGGCGGCGG + Intronic
969699941 4:8762424-8762446 CCCCGGGGGTCTGTGGCTGGAGG - Intergenic
969912257 4:10457365-10457387 CGCCGGCGGTCTGCGGCCGGCGG - Intronic
973293415 4:48490993-48491015 CGTCGTCGGACTGCGGCCGCCGG - Exonic
973616368 4:52682483-52682505 CGCCTTCGGTCTGTGGCCGAAGG + Intergenic
973907627 4:55546913-55546935 CGCCGGCCGTCTGAGCCCGCGGG - Intronic
975701993 4:77075725-77075747 CGGCGGCGGCCTCAGGCCGGGGG - Exonic
976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG + Intronic
981093467 4:140756307-140756329 GGCCGGGCGTCTGCGGCCGCGGG - Intergenic
985696705 5:1344987-1345009 GGCCGGCGGTCTGCGGCGCGCGG - Exonic
989983066 5:50666514-50666536 CCCCGGCAGCCCGCGGCCGGCGG + Intronic
989983084 5:50666554-50666576 CGCGGAGGGTCTGCGGCGGGCGG + Intronic
991676564 5:69094300-69094322 CGGCGGCGGCCTTGGGCCGGTGG + Exonic
992627348 5:78648148-78648170 CGCTGGCGGGCTTCGGACGGCGG - Intronic
1000330160 5:160199547-160199569 CCCCGTCGGCCTGGGGCCGGCGG + Intronic
1001401933 5:171451065-171451087 CGCGGGCGGGAGGCGGCCGGCGG - Intronic
1004864261 6:19837795-19837817 CGCCGTCGGGCTGCGGCGGCGGG + Exonic
1006458555 6:34145150-34145172 CGCAGGCAGTCGACGGCCGGAGG + Intronic
1007665279 6:43509887-43509909 CGCGGGCGGAGTGGGGCCGGGGG + Exonic
1008952197 6:57172862-57172884 CGCGGGCGGTTAGCGGACGGAGG + Intronic
1013463810 6:110400005-110400027 CTCCGCCGGTCTCCGGCCGATGG + Intronic
1019444865 7:1066106-1066128 CGCCGGCAGCCGGCGGCTGGAGG + Intronic
1019481709 7:1269989-1270011 AGCCGGCTGTTTGCGGCAGGTGG + Intergenic
1020224902 7:6272426-6272448 CGCCGGCGGCCTGGGGTCGGGGG - Intronic
1025069783 7:55887848-55887870 CGGCGGCGGGCGGCGGGCGGCGG + Intronic
1029348738 7:99997719-99997741 CGACGGCGGTCTGCGGCTGTCGG + Intergenic
1032021762 7:128410367-128410389 CGCGGGAGGTCTGCGGTCTGCGG - Intergenic
1032754526 7:134876183-134876205 CCCAGGAGGTCTGCGGACGGAGG - Intronic
1034622125 7:152464217-152464239 GGACGGCGGCCGGCGGCCGGCGG - Intergenic
1036454126 8:8893156-8893178 CTCCCGCGCTCGGCGGCCGGCGG + Exonic
1036676697 8:10839855-10839877 CGCCGGCGGACTGCAGCGGACGG + Exonic
1038727642 8:30095548-30095570 CGCGGGAGGGCTGGGGCCGGCGG + Intronic
1044663368 8:94612819-94612841 CGCCGGCAGGCGGAGGCCGGAGG - Intergenic
1048472057 8:134712721-134712743 GGCCGGCGGCCGGCGGCCGGCGG + Intronic
1049998375 9:1051714-1051736 CGGCGGCGGGCTGGGCCCGGGGG - Exonic
1052991806 9:34522979-34523001 CGCGGGCGGTCTGCGGTGAGCGG + Exonic
1052991864 9:34523208-34523230 GGCCGGCGGCCTGCGGCCCGGGG + Intergenic
1060139891 9:121201253-121201275 CGGGGGCGGGCTGCGGCCGCGGG + Intronic
1060700988 9:125748174-125748196 GGCCGGCCGACTGCGGCCAGCGG - Intronic
1060811296 9:126612760-126612782 GACCGGCTGTCTGCGGCCCGTGG - Intergenic
1061128187 9:128689707-128689729 CGCCGGCGGCCTGCGGGCCGGGG - Intronic
1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203479236 Un_GL000220v1:160712-160734 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1200100712 X:153688154-153688176 CGCCCGCGGTCTGCAAGCGGCGG - Exonic