ID: 969915982

View in Genome Browser
Species Human (GRCh38)
Location 4:10492174-10492196
Sequence CTCAGAGTCTCCCATGGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1618
Summary {0: 1, 1: 0, 2: 4, 3: 122, 4: 1491}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969915975_969915982 24 Left 969915975 4:10492127-10492149 CCCTAAAGAGCGAAGGGAATTTC 0: 1
1: 0
2: 1
3: 6
4: 104
Right 969915982 4:10492174-10492196 CTCAGAGTCTCCCATGGCTAGGG 0: 1
1: 0
2: 4
3: 122
4: 1491
969915976_969915982 23 Left 969915976 4:10492128-10492150 CCTAAAGAGCGAAGGGAATTTCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 969915982 4:10492174-10492196 CTCAGAGTCTCCCATGGCTAGGG 0: 1
1: 0
2: 4
3: 122
4: 1491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969915982 Original CRISPR CTCAGAGTCTCCCATGGCTA GGG Intronic
900420459 1:2553890-2553912 CTCAGAGCCCCCCATGGCCTGGG + Intergenic
900735434 1:4296787-4296809 CTCACAGTTCCACATGGCTAGGG + Intergenic
900846054 1:5101918-5101940 CTCACAGTCCCACATGGCTGGGG - Intergenic
900889231 1:5437540-5437562 CTTAGAGTTCCACATGGCTAGGG + Intergenic
901133396 1:6977021-6977043 CTCACAGTTCCACATGGCTAGGG - Intronic
901181247 1:7343221-7343243 CTCAGCGACTCCGATGGCTTGGG + Intronic
901387668 1:8921674-8921696 CTGAGAGGCTCCCATGGTGAAGG - Intergenic
901885736 1:12221725-12221747 CTCACAGTTCCACATGGCTAGGG + Intergenic
902085221 1:13854967-13854989 CTCACAGTTCCACATGGCTATGG - Intergenic
904487650 1:30838019-30838041 CTCAGAGTCTTCCATACCCAGGG - Intergenic
905487922 1:38319103-38319125 CTCAGAGTTTCTAATGGCTGGGG + Intergenic
905808318 1:40893203-40893225 CTCACAGTTTCACATGGCTGGGG + Intergenic
906690993 1:47792733-47792755 AGCAGAGTCTCCCAGGGCTGGGG - Intronic
906848320 1:49218965-49218987 CTCACAGTTCCACATGGCTAGGG - Intronic
907096298 1:51784302-51784324 CTCACATTCCCCAATGGCTATGG + Exonic
907415572 1:54311726-54311748 GTCAGAGTCTCCAATTTCTAAGG + Intronic
907565564 1:55430474-55430496 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
907582614 1:55585473-55585495 CTCAGAGTTCCACATGGCTGGGG + Intergenic
908205586 1:61844924-61844946 CTCACAGTTTCGCATGGCTGGGG - Intronic
908487780 1:64611926-64611948 CTCACAGTTCCACATGGCTATGG + Intronic
908598346 1:65711757-65711779 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
908632775 1:66128727-66128749 CTCACAGTTCCACATGGCTAGGG + Intronic
908930699 1:69313275-69313297 CTCAGCGTCTCCCTTGGCCGCGG + Intergenic
909044255 1:70690174-70690196 CTCACAGTTCCACATGGCTAAGG - Intergenic
909065413 1:70930568-70930590 CTTACAGTTTCACATGGCTAGGG + Intronic
909085802 1:71169110-71169132 CTCACAGTTCCACATGGCTAGGG + Intergenic
909137175 1:71816408-71816430 CTCACAGTGCCACATGGCTAGGG + Intronic
909177479 1:72379705-72379727 CTCACAGTTCCACATGGCTAGGG + Intergenic
909235775 1:73151696-73151718 CTCACAGTTTCACATGACTAGGG + Intergenic
909280363 1:73743731-73743753 TTCACAGTTTCACATGGCTAGGG + Intergenic
909396991 1:75181480-75181502 CTCAGAGGGTCCCATGCCCATGG - Intergenic
909436038 1:75643782-75643804 CTCACAGTCCCACATGGCTGAGG - Intergenic
909672342 1:78203318-78203340 CTCACGGCCTCCCCTGGCTAGGG - Intergenic
909795883 1:79735380-79735402 CTCACAGTTTCACATGGCTGGGG + Intergenic
909826123 1:80128663-80128685 CTTACAGTTTCACATGGCTAGGG + Intergenic
909974069 1:82025072-82025094 CTCACAGTTTCGCATGGCTTGGG + Intergenic
910057087 1:83046031-83046053 CTCACAGTTCCCCATGGGTAGGG + Intergenic
910357695 1:86378567-86378589 CTCACAGTTCCACATGGCTAGGG + Intronic
910367638 1:86483895-86483917 CTCACAGTTCCACATGGCTAGGG + Intronic
910706750 1:90138829-90138851 CTCAGAGTTCCACATGGCTGGGG + Intergenic
911009209 1:93261924-93261946 CTCACAGTTTCACATGGCTGGGG + Intronic
911213185 1:95164276-95164298 CTCAGAGGGTCCCATGCCCACGG - Intronic
911228345 1:95332540-95332562 CTCACAGTTTCACATGGCTGGGG - Intergenic
911255617 1:95629592-95629614 CTCACAGTTTCGCATGGCTAGGG - Intergenic
911286239 1:95997114-95997136 CTCACAGTTCCCCATGGCTGGGG + Intergenic
911535132 1:99090422-99090444 CTTAGAGTTCCACATGGCTAGGG - Intergenic
911695715 1:100889140-100889162 CTCATAGTTCCACATGGCTAGGG + Intronic
911740947 1:101386286-101386308 CTCACAGTTTCACATGGCTAGGG + Intergenic
911941797 1:104056973-104056995 CTCACAGTTTCCCTTGGGTAGGG - Intergenic
912056463 1:105605164-105605186 CTCACAGTTCCACATGGCTAGGG - Intergenic
912136601 1:106667612-106667634 CTCAGAGTTTCACATGGCTGGGG + Intergenic
912182578 1:107236835-107236857 CTCACAGTTTCACATGGCTGGGG - Intronic
912225769 1:107732573-107732595 CTCAGAGGGTCCCATGCCCACGG + Intronic
913108724 1:115639700-115639722 CTCATGGTTTCCCTTGGCTAGGG + Intergenic
913710418 1:121477476-121477498 CTCAGAGGGTCCCATGCCCATGG + Intergenic
914400420 1:147314961-147314983 CTTACAGTCTCCCTTGGCTTGGG + Intergenic
914849555 1:151304008-151304030 CTGAGAGTCCCCCAAGGATAGGG + Intronic
914896774 1:151682608-151682630 CTCACAGTTTCGCATGGCTTGGG + Intronic
914949037 1:152094832-152094854 CTCACAGTTCCACATGGCTAGGG + Intergenic
915045689 1:153012910-153012932 CTCAGAGTCTCCCTTGTTTTTGG - Intergenic
915058542 1:153159673-153159695 CTCACAGTTTTGCATGGCTAGGG + Intergenic
915446996 1:155979531-155979553 CTCAGGGTCTCCCATTTCTCTGG + Intronic
915654551 1:157348499-157348521 CTCACAGCCTCCCTTGGCTAGGG + Intergenic
915763225 1:158336436-158336458 CTCAGAGGGTCCCATGCCCATGG + Intergenic
915856138 1:159388074-159388096 CTCACAGTTTCCCATGGCTTGGG - Intergenic
915989393 1:160498406-160498428 CTCACAGTTCCCCATGGCTGGGG + Intronic
916024832 1:160824325-160824347 ATCCGAGATTCCCATGGCTAAGG + Intronic
916036013 1:160923031-160923053 CTCACAGTTTCACATGGCTGGGG - Intergenic
916036545 1:160927567-160927589 CTCTGAGTCTACCCTGGCTCAGG - Intergenic
916406206 1:164500393-164500415 CTCAGGGCTTCCCTTGGCTAGGG - Intergenic
916766081 1:167862004-167862026 CTCACAGTTCCACATGGCTAGGG - Intronic
916878787 1:168998795-168998817 CTCATGGTTTCCCTTGGCTAGGG + Intergenic
916916033 1:169407843-169407865 CTCACAGCTTCCCTTGGCTAGGG - Intronic
917023437 1:170614755-170614777 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
917090270 1:171346110-171346132 CTTACAGTCTCACATGGCTGGGG - Intergenic
917273609 1:173305720-173305742 CTCACAGTTTCACATGGCTGGGG + Intergenic
917573686 1:176296876-176296898 CTCAGAGGGTCCCATGCCCATGG - Intergenic
917895175 1:179480250-179480272 CTCAGAGTTCCACATGGCTGGGG + Intronic
917915147 1:179694266-179694288 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
918015386 1:180628633-180628655 CTCACAGTTCCACATGGCTAGGG + Intergenic
918018866 1:180665085-180665107 CTCACAGTTTCCCATTGCTGAGG + Intronic
918353746 1:183684815-183684837 CTCACAGCTTCCCTTGGCTAGGG + Intronic
918501561 1:185201478-185201500 CTCACAGCTTCCCTTGGCTAGGG + Intronic
918740057 1:188118802-188118824 CTCACAGTTTCACATGGCTTGGG + Intergenic
918836770 1:189475409-189475431 CTCACAGTTCCACATGGCTAGGG + Intergenic
918844217 1:189587609-189587631 CTCACAGTTCCCCATGGCTGGGG - Intergenic
918864868 1:189882249-189882271 CTCACAGTTCCACATGGCTAGGG - Intergenic
918935394 1:190914894-190914916 CTCACAGTTTCACATGGCTGGGG - Intergenic
918935624 1:190916870-190916892 CTCACAGTTTCACGTGGCTAGGG - Intergenic
918955151 1:191198647-191198669 CTCATGGGCTCCCTTGGCTAGGG - Intergenic
918978127 1:191517266-191517288 CTCACAGTCGCACATGGCTGGGG - Intergenic
919008318 1:191928351-191928373 CTGAGATTCTCCTCTGGCTAGGG - Intergenic
919214802 1:194538591-194538613 CTCACAGTTTCACATGGCTGGGG + Intergenic
919277590 1:195440667-195440689 CTCACAGTTTCGCATGGCTTGGG + Intergenic
919302262 1:195785673-195785695 CTCACAGTTTCACATGGCTGGGG - Intergenic
919332877 1:196193358-196193380 CTCAGAGGGTCCCATGCCCATGG - Intergenic
919601830 1:199632758-199632780 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
920614541 1:207477178-207477200 CTCACAGTTTCACATGGCTGGGG + Intronic
921188601 1:212690734-212690756 CTCAAACCCTCCCATGGCAAAGG - Intronic
921453796 1:215342331-215342353 CTCACAGTCCCACATGGCTGGGG + Intergenic
921758465 1:218884953-218884975 CTCACAGTTCCACATGGCTAGGG + Intergenic
921775816 1:219098042-219098064 CTCAGAGTTCCACATGGCTAAGG - Intergenic
921962169 1:221047347-221047369 CTCATGGCCTCCCATGGCTAGGG - Intergenic
922198666 1:223382385-223382407 TTCAGAGCCTCCCTTGGCTGCGG - Intergenic
922231132 1:223687468-223687490 CTCACAGTTTCACATGGCTGGGG - Intergenic
922672228 1:227519265-227519287 CTGAGAGTCTCCCCTGGCCTGGG + Intergenic
923368580 1:233287597-233287619 CTCACAGTTTCACATGGCTAGGG - Intronic
923395598 1:233559239-233559261 CTCACAGTTTTGCATGGCTAAGG - Intergenic
923421661 1:233822184-233822206 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
923428180 1:233892527-233892549 CTCACAGTCCCACAGGGCTAGGG - Intergenic
923433377 1:233945835-233945857 CTCACAGTCACACATGGCTGGGG - Intronic
923719188 1:236452588-236452610 CTCAGAGTTCCACATGGCTGAGG - Intronic
923853361 1:237820437-237820459 CTCACAGTTTCCCTTGGCTAGGG - Intronic
923932977 1:238723115-238723137 CTCACAGATTCACATGGCTAGGG - Intergenic
924246200 1:242087421-242087443 CTATGAGTGTCCCATGGCTGTGG + Exonic
1063052977 10:2474037-2474059 CTCATAGTGCCACATGGCTAGGG + Intergenic
1063582610 10:7322304-7322326 CTCAGAGTTTCACATGGCTGGGG - Intronic
1063719396 10:8564626-8564648 CTCACAGTTCCACATGGCTAGGG + Intergenic
1063920892 10:10931830-10931852 CTCACAGTTCCACATGGCTAGGG + Intergenic
1063927865 10:10998112-10998134 CTCACAGTTTCACATGGCTGAGG - Intergenic
1064206151 10:13325574-13325596 CTCACAGTTTCACATGGCTGGGG - Intronic
1064300468 10:14118598-14118620 CTCACAGTTCCACATGGCTATGG + Intronic
1064528844 10:16286031-16286053 CTCACAGTTCCACATGGCTAGGG + Intergenic
1064647432 10:17473898-17473920 CTCACAGTTTCACATGGCTGGGG - Intergenic
1064691088 10:17919053-17919075 CTCACAGTTTCACATGGCTGCGG - Intergenic
1064793592 10:18987436-18987458 CTCACAGTTCCACATGGCTAGGG + Intergenic
1064893533 10:20208249-20208271 CTCACAATTTCCCATGGCTAGGG + Intronic
1065236238 10:23655304-23655326 TGCGCAGTCTCCCATGGCTAGGG + Intergenic
1065373469 10:25013150-25013172 CTCACAGTTTCACATGGCTGAGG - Intronic
1065376697 10:25050367-25050389 CTCACAGTTCCACATGGCTAGGG + Intronic
1065441746 10:25759712-25759734 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1065455769 10:25905129-25905151 CTCACAGTTCCCCATGGCTGGGG - Intergenic
1065705333 10:28467032-28467054 CTCACAGTTTCACATGGCTGGGG + Intergenic
1065852824 10:29805024-29805046 CTCACAGTCCCACATGGCTGGGG - Intergenic
1066278619 10:33892514-33892536 CTCAAAGTTCCACATGGCTAGGG + Intergenic
1066530644 10:36334812-36334834 CCCAGACTCTTCCCTGGCTAAGG - Intergenic
1066680254 10:37931194-37931216 CTCACAGTATCACGTGGCTAGGG + Intergenic
1067209759 10:44250130-44250152 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
1067347492 10:45447041-45447063 ATCAGGGTCTCCCATGTCTCTGG + Intergenic
1067826981 10:49583231-49583253 CTCACAGTTCCACATGGCTAGGG + Intergenic
1068001632 10:51341789-51341811 CTCAGAGTTCCCCATGGCTGGGG + Intronic
1068198684 10:53753257-53753279 CTCACAGTTTCACATGGCTGGGG + Intergenic
1068222182 10:54058331-54058353 CTCACAGTTTCACATGGCTCAGG + Intronic
1068380584 10:56248901-56248923 CTCACAGTTCCACATGGCTAGGG + Intergenic
1068509534 10:57946710-57946732 CTCACAGTTCCACATGGCTACGG - Intergenic
1068575094 10:58676048-58676070 CTCATAGCTTCCCTTGGCTAGGG - Intronic
1068951503 10:62782218-62782240 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1069095158 10:64250184-64250206 CTCACAGTTCCACATGGCTAGGG + Intergenic
1069224471 10:65924782-65924804 CTCACAGTTTCACAGGGCTAGGG + Intronic
1069246732 10:66216369-66216391 CTCACTGTCACCCATGACTAGGG + Intronic
1069270050 10:66515626-66515648 CTCACAGTTCCACATGGCTAGGG + Intronic
1069424661 10:68278937-68278959 CTCACAGTTTCACATGGCTGGGG - Intergenic
1069557035 10:69405199-69405221 CCAAGAGCCTCCCATGGCTCAGG + Intronic
1069804299 10:71108344-71108366 CTCAGAGTTCCACATGGCTGAGG - Intergenic
1070068929 10:73066885-73066907 CTCACAGTTCCGCATGGCTACGG - Intronic
1070662665 10:78318751-78318773 CTCATAGTCTCACGTGGCTGGGG + Intergenic
1071002090 10:80841979-80842001 CTCAGAGCTTCCCTTGGCTAGGG + Intergenic
1071211150 10:83343154-83343176 CTCAGAGGGTCCCATGCCCATGG - Intergenic
1071657962 10:87469890-87469912 CTCACAGTTTCACATGGCTGGGG + Intergenic
1071722586 10:88162381-88162403 CTCAGAATTTCACATGGCTGGGG - Intergenic
1071723316 10:88169507-88169529 CTCACAGTTCCACATGGCTACGG + Intergenic
1071753901 10:88514148-88514170 CTCATAGTTTCACATGGCTGGGG + Intronic
1071818901 10:89260627-89260649 CTCAGAGTCTCACAGGCCTTTGG + Intronic
1071824974 10:89316432-89316454 CTCAGAGGGTCCCATGCCCAGGG + Intronic
1071931173 10:90472149-90472171 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1071978092 10:90975615-90975637 GTCAGAGTCACCAATGGCTGAGG - Intergenic
1071980869 10:91003409-91003431 CTCACAGTTTCACATGGCTGGGG + Intergenic
1071981158 10:91005354-91005376 CTCACAGTCCCACATGGCTGGGG + Intergenic
1072273867 10:93803063-93803085 CTCACAGTTTCACATGGCTGGGG - Intergenic
1072384320 10:94908846-94908868 CTCAGAGAGTCCCGTGCCTATGG + Intergenic
1072384898 10:94914642-94914664 CTCAGAGGGTCCCATGTCTATGG + Intergenic
1072403814 10:95130994-95131016 CTCACAGTTTCACATGGCTTGGG - Intergenic
1072493769 10:95934615-95934637 CTCAGGGCTTCCCTTGGCTAGGG + Intronic
1072647508 10:97268543-97268565 CTCACAGTTCCACATGGCTAGGG + Intronic
1072722965 10:97792104-97792126 CCCAGTGTCTCCCATGTCTCCGG + Intergenic
1072769225 10:98123891-98123913 CTCATAGTTTCACATGGCTGGGG + Intergenic
1072876108 10:99175027-99175049 CTCACAGCTTCCCTTGGCTAGGG - Intronic
1073571373 10:104583512-104583534 CTCACAGTTCCACATGGCTAGGG - Intergenic
1074889614 10:117724533-117724555 CTCACAGTTTCACATGGCTGGGG + Intergenic
1075168784 10:120093826-120093848 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1075175404 10:120155923-120155945 CTCAGGGCTTCCCTTGGCTAGGG - Intergenic
1075209401 10:120478225-120478247 CTCATAGTGACCCATGCCTAGGG + Intronic
1075515923 10:123108111-123108133 CTCACAGTTCCCCATGGCTGGGG - Intergenic
1075669601 10:124255317-124255339 CTCAGAGTTTCACATGGCTGGGG - Intergenic
1076261793 10:129072302-129072324 CTCACAGTTTCACATGGCTGGGG - Intergenic
1076928896 10:133514215-133514237 CTCACAGTTTCACATGGCTGCGG + Intergenic
1077398999 11:2343789-2343811 CTCACAGTCCCACATGGCTGGGG - Intergenic
1078193086 11:9109524-9109546 CTCACAGTTCCACATGGCTAGGG - Intronic
1078765572 11:14293688-14293710 CTCACAGTTTCACATGGCTGGGG - Intronic
1079520155 11:21316801-21316823 CTCAGAGTCTCTTGTGGGTAGGG + Intronic
1079559731 11:21807081-21807103 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1079670640 11:23165910-23165932 CTCACAGTTTCACATGCCTAGGG - Intergenic
1079716859 11:23757853-23757875 CTCACAGTTCCCCATGGCTAGGG - Intergenic
1079736055 11:23998879-23998901 CTCACAGTTCCACATGGCTAAGG + Intergenic
1079736300 11:24000818-24000840 CTCACAGTTCCACATGGCTAAGG + Intergenic
1079752565 11:24217455-24217477 CTCAGAGCATCCCATGCCCACGG + Intergenic
1079799844 11:24854857-24854879 CTCACAGCTTCCCTTGGCTAGGG + Intronic
1079945038 11:26731715-26731737 CTCACAGTTTCACATGGCTAGGG - Intergenic
1080033682 11:27688636-27688658 CTCAGGGCTTCCCTTGGCTAGGG + Intronic
1080136982 11:28866548-28866570 CTCACAGTTTCACATGGGTAGGG + Intergenic
1080247088 11:30191666-30191688 CTCACAGTTCCACATGGCTAGGG + Intergenic
1080559609 11:33450943-33450965 CTCAGATTCTCTCATGGGCATGG - Intergenic
1080751869 11:35158156-35158178 CTGAGTGTCTCCCAGGGCTCTGG - Intronic
1080889016 11:36392647-36392669 CTCACAGTTCCGCATGGCTAGGG + Intronic
1080979071 11:37378299-37378321 CTCATAGTTTCACATGGCTGGGG + Intergenic
1081080321 11:38732682-38732704 CTCACAGTTTCACATGGCTGAGG + Intergenic
1081122787 11:39286788-39286810 CTCAAAGTTCCACATGGCTAGGG + Intergenic
1081321769 11:41700313-41700335 CTCATAGTTCCACATGGCTAGGG + Intergenic
1081334603 11:41848949-41848971 CTCACAGTTTCACATGGCTGAGG - Intergenic
1081373492 11:42333001-42333023 CTCATAGTTCCCCATGGCTGAGG + Intergenic
1081455668 11:43220088-43220110 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1082288203 11:50339367-50339389 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1082664064 11:55951271-55951293 CTCACAGTTCCACATGGCTAGGG - Intergenic
1082692530 11:56323864-56323886 CTCACAGTTTCACATGGCTGAGG - Intergenic
1082876382 11:57992903-57992925 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1082951057 11:58816317-58816339 CTCAGAGGGTCCCATGCCCATGG + Intergenic
1083136238 11:60679199-60679221 CTCACAGTTTCACATGGCTGGGG + Intergenic
1083698035 11:64455679-64455701 CTCAGTTTCTCCCAGGGCTTGGG - Intergenic
1084221253 11:67681135-67681157 CTCACAGTTTAGCATGGCTAGGG + Intronic
1084443243 11:69188077-69188099 CTCACAGTCCCACATGGCTGGGG + Intergenic
1084453862 11:69256195-69256217 CTCACAGTTCCCCATGGCTGGGG + Intergenic
1085169292 11:74434759-74434781 CTCACAGTTTCACATGGCTGGGG - Intergenic
1085860658 11:80230542-80230564 CTCACAGTTTCACATGGCTGGGG - Intergenic
1085874058 11:80385195-80385217 CTCACAGTTCCACATGGCTAGGG + Intergenic
1085904448 11:80743352-80743374 CTCACAGTTTCACATGGCTGGGG + Intergenic
1086129131 11:83382904-83382926 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1086431517 11:86741137-86741159 CTCACAGGCCCCCAAGGCTAAGG + Intergenic
1086682430 11:89689222-89689244 CTCACAGTTTCCTATGGCTGGGG + Intergenic
1086767429 11:90715071-90715093 CTCAGAGTTTCACAAGGCTAGGG - Intergenic
1086849554 11:91793220-91793242 CCCAGAGTCTCACAGGGCTCTGG + Intergenic
1086869471 11:92019022-92019044 CTCACAGTTTCACACGGCTAGGG + Intergenic
1087148358 11:94834666-94834688 CTCTGACTCTCCCATTGCCAAGG - Intronic
1087400535 11:97659875-97659897 CTCACAATTTCACATGGCTAGGG - Intergenic
1087596063 11:100256714-100256736 CTCACAGCTTCCCTTGGCTAGGG - Intronic
1087777040 11:102266052-102266074 CTCAGAGATTCCCATAGCAATGG - Intergenic
1087908389 11:103725464-103725486 CTCACAGTTTCACATGGCTGGGG + Intergenic
1087917067 11:103823304-103823326 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1088026838 11:105195744-105195766 CTCACAGTGCCACATGGCTAGGG + Intergenic
1088034683 11:105296905-105296927 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
1088116978 11:106323561-106323583 CTCACAGTTTCACATGGCTGAGG + Intergenic
1088601027 11:111475821-111475843 CTCACAGTCCCACATGGCTGGGG + Intronic
1089064584 11:115652776-115652798 CTCAGAGTTCCGCATGGCTGGGG - Intergenic
1089161743 11:116443402-116443424 CTCAGGGTCTCACAAGGCTGAGG - Intergenic
1090106370 11:123856993-123857015 CTCACAGTTTCACATGGCTGGGG + Intergenic
1090117150 11:123985120-123985142 CTCACTGCCTCCCTTGGCTAGGG + Intergenic
1090169993 11:124592830-124592852 CTGGGACTCTCCCACGGCTAAGG - Intergenic
1090575065 11:128093687-128093709 CTCACAGTTTCACATGGCTCAGG + Intergenic
1090928766 11:131276917-131276939 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1091294174 11:134461133-134461155 GTCTGAGTCTCCCAAGGCTGTGG + Intergenic
1092330116 12:7579050-7579072 CTCACAGTTTCACATGGCTGGGG + Intergenic
1092638823 12:10481586-10481608 CTCACAGCTTCCCTTGGCTAAGG - Intergenic
1092665290 12:10790737-10790759 CTCACAGTTTCACATGGCTAGGG + Intergenic
1092978676 12:13771259-13771281 CTCACAGTTTCACATGGCTGGGG - Intronic
1093085943 12:14867128-14867150 CTCAGAGGCTCCCACGCCCATGG - Intronic
1093162412 12:15764069-15764091 CTCACAGTTCCACATGGCTAGGG + Intronic
1093271447 12:17067122-17067144 CTCACAGTTTCACATGGCTGAGG - Intergenic
1093489271 12:19686166-19686188 CTCACAGTCTTGCATGGCTGGGG - Intronic
1093492466 12:19720674-19720696 CTCACAGTTTCACATGGCTGAGG - Intronic
1093774265 12:23053855-23053877 CTCACAGTTCCACATGGCTAGGG - Intergenic
1093931082 12:24955640-24955662 CTCACAGTTTCACATGGCTGGGG - Intergenic
1094169803 12:27479821-27479843 CTCACAGTCCCACATGGCTGGGG - Intronic
1094367947 12:29703999-29704021 CTCACAGTTTCACATGGCTGGGG - Intronic
1094368996 12:29715705-29715727 CTCAGAGTTCCACATGGCTGGGG + Intronic
1094441347 12:30480438-30480460 CTCACAGTCCCGCATGGCTAAGG - Intergenic
1094767724 12:33617465-33617487 CTCACAGTTCCACATGGCTAGGG - Intergenic
1094793952 12:33949036-33949058 CTCACAGTTCCACATGGCTAGGG - Intergenic
1095242403 12:39877226-39877248 CTCAGAGTTCCACATGGCTAGGG + Intronic
1095519251 12:43042221-43042243 CTCACAGTTCCACATGGCTAGGG + Intergenic
1095787976 12:46131632-46131654 CTCACAGTTTCACATGGCTGGGG + Intergenic
1095832404 12:46601809-46601831 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1095847352 12:46759954-46759976 CTCACAGTTTCACATGGCTTGGG - Intergenic
1095982168 12:47979936-47979958 CCCAGAGGCTCCCATGGCGGGGG - Intronic
1096044903 12:48553977-48553999 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1096433826 12:51571427-51571449 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1096536963 12:52281091-52281113 CTGAGAGGCTCCCCTGGCCATGG + Intronic
1097084172 12:56455065-56455087 CTCTGAGTCTGCCAGGGGTAAGG + Intronic
1097135156 12:56846956-56846978 CTCACAGTTCCACATGGCTAGGG + Intergenic
1097333259 12:58355243-58355265 CTCACAGTTCCGCATGGCTAGGG - Intergenic
1097420916 12:59378597-59378619 CTCACAGTTTTCCATGGCTTGGG + Intergenic
1097506939 12:60485324-60485346 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1097723978 12:63053461-63053483 CTCACAGTTCCACATGGCTAGGG - Intergenic
1097734613 12:63168035-63168057 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1098015548 12:66100505-66100527 CTCAGAGGGTCCCATGCCCATGG - Intergenic
1098108998 12:67102015-67102037 CTCACAGTTTCACATGGCTGGGG + Intergenic
1098203553 12:68082879-68082901 CTCACAGTTTCACATGGCTGGGG + Intergenic
1098203824 12:68084848-68084870 CTCACAGTTTCACATGGCTGGGG + Intergenic
1098620427 12:72590998-72591020 CTCACAGTTTCACATGGCTAGGG + Intronic
1098743015 12:74199603-74199625 CTCACAGTTCCACATGGCTAGGG + Intergenic
1099072114 12:78058251-78058273 CTCACAGTTTCACATGGCTGGGG + Intronic
1099100380 12:78432565-78432587 CTCACAGTTTCACATGGCTGGGG + Intergenic
1099238999 12:80116277-80116299 CTCACAGTTTCCCTTGGATAGGG + Intergenic
1099313957 12:81062020-81062042 CTCAGAGGGTCTCATGCCTACGG - Intronic
1099502922 12:83435802-83435824 CTCACAGTTTCACATGGCTGGGG - Intergenic
1099551104 12:84044008-84044030 CTCACAGCTTCCCTTGGCTATGG + Intergenic
1099564310 12:84221740-84221762 CTCACAGTTCCCCATGGCTGGGG - Intergenic
1099764877 12:86970745-86970767 CTCGGAGGGTCCCATGGCCATGG + Intergenic
1099869520 12:88329193-88329215 CTCAGAGTTCCACATGGCTTGGG + Intergenic
1099897087 12:88661808-88661830 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1100133813 12:91528933-91528955 CTCACAGTTCCACATGGCTATGG - Intergenic
1100428920 12:94512953-94512975 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1100739977 12:97581303-97581325 CTCAGAGCTTCCCTTGGCTAGGG - Intergenic
1100937757 12:99689991-99690013 CTCACAGTTCCCCATTGCTAGGG + Intronic
1101156141 12:101929605-101929627 CTTACAGTTTCACATGGCTAGGG + Intronic
1101581066 12:106041112-106041134 CTCACAGTTTCACATGGCTGGGG + Intergenic
1101581262 12:106043221-106043243 CTCACAGTTCCACATGGCTAGGG + Intergenic
1101713511 12:107290160-107290182 CTCAGGGTCTCCCTTGCCTCAGG + Intergenic
1101716031 12:107313395-107313417 CTCACAGTTTCACATGGCTAGGG + Intergenic
1101826588 12:108225191-108225213 CTCACAGTTTCACATGGCTGAGG + Intronic
1102353675 12:112214354-112214376 CACAGAGTCTCCTATGGCTTAGG + Intronic
1102722206 12:115026736-115026758 CTCATAGTTTCACATGGCTGGGG - Intergenic
1103255723 12:119539910-119539932 CTCACAGCTTCCCTTGGCTAGGG + Intronic
1103838529 12:123844044-123844066 CTCACAGTCACGCATGGCTGGGG + Intronic
1104039328 12:125119479-125119501 CTCAGAGTTTCACATGACTGGGG + Intronic
1104138371 12:125962162-125962184 CTCACAGTTCCACATGGCTAGGG - Intergenic
1104146391 12:126037890-126037912 CTCACAGTTTCACATGGCTGGGG + Intergenic
1104208345 12:126662081-126662103 CTCATAGTTTCACATGGCTGGGG - Intergenic
1104304820 12:127600142-127600164 CTCACAGTTCCCCATGGCTGGGG - Intergenic
1104403529 12:128497606-128497628 CTCAGAGGGTCCCATGCCCACGG - Intronic
1104723838 12:131062689-131062711 CTCACAGTTCCACATGGCTAGGG - Intronic
1104916372 12:132266914-132266936 CTCAGGGTCTCCCTTGGCTGGGG + Intronic
1105234612 13:18537115-18537137 CTCACAGTTTCACATGGCTGGGG - Intergenic
1105355039 13:19652343-19652365 CTCAGAGATTCCCTTGGCTAGGG - Intronic
1105394509 13:20017195-20017217 CTCTGACTTTACCATGGCTAGGG + Intronic
1105793959 13:23832242-23832264 CTCAGGGCCTCACATGGCGAGGG - Intronic
1106106479 13:26737707-26737729 CTCACAGTTCCACATGGCTAGGG - Intergenic
1106335154 13:28777101-28777123 CTCAGGGCTTCCCTTGGCTATGG + Intergenic
1106929710 13:34651204-34651226 CTCACAGTTCCACATGGCTATGG - Intergenic
1107473522 13:40713080-40713102 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1107554297 13:41504055-41504077 CTCACAGTTTCACATGGCTAAGG + Intergenic
1107611869 13:42122421-42122443 CACAGAGTATCACATGGCAAGGG + Intronic
1107679302 13:42831718-42831740 CTCACAGTTACACATGGCTAGGG - Intergenic
1107741590 13:43455904-43455926 CTCACAGTTTCACATGGCTGGGG - Intronic
1107968913 13:45622609-45622631 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
1108048868 13:46409319-46409341 CTCACAGCTTCCCTTGGCTAGGG + Intronic
1108106555 13:47016842-47016864 CTCACAGTTCCACATGGCTAGGG - Intergenic
1108140071 13:47411197-47411219 CTCACAGTTCCACATGGCTAGGG - Intergenic
1108270476 13:48755010-48755032 CTCACAGTTCCACATGGCTAGGG - Intergenic
1108383745 13:49879299-49879321 CTCACAGCTTCCCTTGGCTATGG - Intergenic
1108580355 13:51822973-51822995 GTCAGTGTCTCCCATAGCAAAGG - Intergenic
1108810608 13:54219302-54219324 CTCAGAGGATCCCATGCCCACGG + Intergenic
1108821368 13:54354754-54354776 CTCACAGTTCCACATGGCTAGGG + Intergenic
1108850799 13:54727130-54727152 CTCAGAGTTCCACATGGCTTGGG - Intergenic
1109218012 13:59612505-59612527 CTCACAGTTCCCCATGGCTGTGG + Intergenic
1109246275 13:59957475-59957497 CTCAGAGTTCCACATGGCTGGGG - Intronic
1109253109 13:60045000-60045022 CTCACAGTTTCACATGGCTGGGG - Intronic
1109391703 13:61703391-61703413 CTCACAGTTTCACATGGCTGGGG - Intergenic
1109397555 13:61779847-61779869 CTCACAGTTTCACATGGCTGGGG - Intergenic
1109478325 13:62914788-62914810 CTCACAGTCCCACATGGCTGAGG + Intergenic
1109541399 13:63782665-63782687 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1109681919 13:65763156-65763178 CTCACAGTTTCACATGGCTAGGG + Intergenic
1109846628 13:68000710-68000732 CTCACAGTTTCTCATGGCTAGGG - Intergenic
1109891135 13:68616742-68616764 CTCAGGGCCTCCATTGGCTATGG - Intergenic
1109999500 13:70176669-70176691 CTCAGAGTTCCACATGGCTTGGG - Intergenic
1110072637 13:71196144-71196166 CTCAGAATCCCCCATGCCTGTGG - Intergenic
1110401489 13:75096767-75096789 CTCACAGTCTCACATGGCTGAGG + Intergenic
1110475378 13:75907446-75907468 CTCACAGTTCCACATGGCTAGGG - Intergenic
1110543495 13:76731182-76731204 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1110666213 13:78120259-78120281 CTCACAGTTCCACATGGCTAGGG + Intergenic
1110734474 13:78919753-78919775 CTCAAAGTTCCACATGGCTAGGG - Intergenic
1110882472 13:80589226-80589248 CTCACAGTTCCACATGGCTAGGG + Intergenic
1111239551 13:85456769-85456791 CTCACAGTTCCACATGGCTAGGG - Intergenic
1111585049 13:90272903-90272925 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1111628958 13:90825740-90825762 CCCACAGTCCCACATGGCTATGG + Intergenic
1111751188 13:92334186-92334208 CTCACAGTTCCACATGGCTAGGG + Intronic
1111782101 13:92741353-92741375 CTCAGAGCCTCCCACGGCAAAGG - Intronic
1111909393 13:94293485-94293507 CTCACAGTTCCCCATGGCTGGGG - Intronic
1111967016 13:94871130-94871152 CTCAGAGGGTCCCATGCCCATGG + Intergenic
1111980183 13:95007344-95007366 CTCACAGTTTCTCATGGCTGGGG + Intergenic
1112033852 13:95480018-95480040 CTCACAGTTCCACATGGCTAGGG + Intronic
1112062166 13:95751788-95751810 CTCACAGTTTCACATGGCTGGGG + Intronic
1112073684 13:95883686-95883708 CTCACAGTTTCGCATGGCTAGGG - Intronic
1112151848 13:96773078-96773100 CTCAGGGCTTCCCTTGGCTAGGG - Intronic
1112165781 13:96918605-96918627 CTCAGGGCTTCCCTTGGCTAGGG - Intergenic
1112186971 13:97137004-97137026 CTCACAGTTTCACATGGCTGGGG + Intergenic
1112433154 13:99370669-99370691 CTCATAGCCACCCATGGGTAAGG + Intronic
1112876945 13:104053589-104053611 CTCACAGTTCCCCATGGCTTTGG - Intergenic
1112904629 13:104401435-104401457 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1112953281 13:105029359-105029381 CTCATAGTTCCACATGGCTATGG + Intergenic
1113016188 13:105830800-105830822 CTCACAGTTTCACATGGCTGGGG - Intergenic
1113101226 13:106721742-106721764 CACAGAGAGTCCCATGGCAAAGG - Intergenic
1113131624 13:107043160-107043182 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1113298214 13:108985970-108985992 CTCACAGTTCCACATGGCTAGGG + Intronic
1113359711 13:109619085-109619107 CTCACAGTTTCACATGGCTGGGG + Intergenic
1113556369 13:111238941-111238963 CTCAGAGTTCCGCATGGCTGGGG + Intronic
1114579517 14:23744700-23744722 CTCAGAGAGTCCCATGCCCACGG - Intergenic
1115198951 14:30833368-30833390 CTCACAGTTCCACATGGCTAGGG + Intergenic
1115281570 14:31668767-31668789 CTCAGGGCTTCCCTTGGCTAAGG + Intronic
1115511204 14:34139554-34139576 CTCAGGGCTTCCCTTGGCTAGGG - Intronic
1115790363 14:36871082-36871104 AGCAGAGTGTCCCCTGGCTATGG + Intronic
1115841385 14:37474569-37474591 CTCACAGTTACACATGGCTAGGG - Intronic
1115883219 14:37944209-37944231 CTCAGAGTTCCACATGGCTGGGG + Intronic
1115980438 14:39046149-39046171 CTCACAGTTTCACATGGCTGGGG - Intronic
1116061162 14:39925951-39925973 CCCAGTGTCTACCATGACTAAGG + Intergenic
1116098056 14:40397063-40397085 CTCACAGTTCCCCATGGCTGGGG - Intergenic
1116265833 14:42688296-42688318 CTCACAGTTTTGCATGGCTAGGG + Intergenic
1116286341 14:42977130-42977152 CTCACAGTTTCACATGGCCAGGG + Intergenic
1117086670 14:52208516-52208538 CTCAGAGGGTCCCATGCCCACGG + Intergenic
1117358445 14:54948417-54948439 CTCAGAGGGTCCCATGCCCATGG + Intronic
1117568190 14:57017923-57017945 CTCACAGTTCCACATGGCTAGGG - Intergenic
1117716135 14:58583500-58583522 CTCAGGGCTTCCCTTGGCTAAGG + Intergenic
1117896653 14:60494613-60494635 ATCAGAGTCTCCCAATGCTAGGG - Intronic
1117990026 14:61424125-61424147 CTCATAGTTCCACATGGCTAGGG - Intronic
1118051717 14:62036582-62036604 CTCACAGTTCCACATGGCTAGGG + Intronic
1118060664 14:62134866-62134888 CTCACAGTTTCACATGGCTGGGG + Intergenic
1118427685 14:65684820-65684842 CTCACAGTTTCACATGGCTGGGG - Intronic
1118516163 14:66530686-66530708 CTCAGGGCTTCCCTTGGCTACGG + Intronic
1118518576 14:66554422-66554444 CTCACAGTTGCACATGGCTAGGG + Intronic
1118519873 14:66571111-66571133 CTCACAGTTCCACATGGCTAGGG + Intronic
1118523779 14:66617429-66617451 CTCACTGCCTCCCTTGGCTATGG + Intronic
1118590746 14:67399116-67399138 CTTACAGTCTCCCAGTGCTAAGG + Intronic
1118881517 14:69830480-69830502 CTCACAGTTCCCCATGGCTGGGG + Intergenic
1119273586 14:73331840-73331862 CTCAGAGTTCCTCATGGCTGGGG - Intronic
1119586351 14:75839479-75839501 CTCACAGTTTCACATGGCTGGGG + Intronic
1119721596 14:76895148-76895170 CCCAGACTCTCCCATGGGTGAGG + Intergenic
1119994771 14:79241380-79241402 CTCACAGTTCCACATGGCTAGGG + Intronic
1120038002 14:79720111-79720133 CTCAGAGTTCCACATGGCTAGGG + Intronic
1120060829 14:79979797-79979819 CTCACAGTTCCACATGGCTAGGG - Intergenic
1120102731 14:80463994-80464016 CTCACAGTCCCACATAGCTAGGG + Intergenic
1120229080 14:81823231-81823253 CTCACAGTTCCACATGGCTAGGG + Intergenic
1120648669 14:87103607-87103629 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1120719216 14:87872270-87872292 CTCACAGTTTCACATGGCTGGGG + Intronic
1120789696 14:88568369-88568391 CTCAGAGTTCCACATGGCTGGGG + Intronic
1120818208 14:88885010-88885032 CTCACAGTTTCACATGGCTGAGG + Intergenic
1120861282 14:89257101-89257123 GTGAGAGTCCCCCAGGGCTAGGG + Intronic
1120920909 14:89754832-89754854 CTCACAGTTTCACATGGCTGAGG + Intergenic
1120947771 14:90013933-90013955 CTCACAGTTCCACATGGCTAGGG - Intronic
1121470661 14:94151767-94151789 CTCAGAGCTTCCCTTGGCTAGGG + Intronic
1121728460 14:96169982-96170004 TGCAGAGTCTCTGATGGCTAAGG + Intergenic
1121834438 14:97079304-97079326 TTCAGGGTCTCCCATGGCCAGGG - Intergenic
1121898928 14:97674533-97674555 CTCATGGTGTCCCTTGGCTAGGG - Intergenic
1121965900 14:98305393-98305415 CTCACAGTCCCACATGGCTGGGG - Intergenic
1122360170 14:101154528-101154550 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1122846357 14:104501700-104501722 CTCACAGTTCCACATGGCTAGGG - Intronic
1122863412 14:104592923-104592945 CACAGGGTCTCCCAGGCCTATGG + Intronic
1122995805 14:105263270-105263292 CTCACAGTCTCGCTTGGCAAGGG + Intronic
1123186608 14:106523855-106523877 CTCACAGTTTCACATGGCTGGGG - Intergenic
1123480748 15:20628984-20629006 CTCACGGCCTCCCTTGGCTAGGG - Intergenic
1123637262 15:22371383-22371405 CTCACGGCCTCCCTTGGCTAGGG + Intergenic
1123802384 15:23834750-23834772 CTCACAGTTCCACATGGCTAGGG + Intergenic
1123829122 15:24115929-24115951 CTCACAGTTTCACATGGCTGGGG + Intergenic
1124039548 15:26088041-26088063 CTCAGAGTCTACTCTGGCTCAGG - Intergenic
1124561244 15:30775508-30775530 CTCAGAGGGTCCCATGCCCACGG + Intergenic
1125288453 15:38119635-38119657 CTCATGGTTTCCCTTGGCTAGGG - Intergenic
1125330067 15:38573797-38573819 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1125373087 15:38999732-38999754 CTCACCGTCTCCCTTGGCTGGGG - Intergenic
1125382635 15:39103396-39103418 CTCACAGTTCCACATGGCTAAGG - Intergenic
1126289103 15:47051998-47052020 CTCACAGTTCCACATGGCTAGGG + Intergenic
1126359887 15:47835418-47835440 CTCAGAGTTCCATATGGCTAGGG + Intergenic
1126824913 15:52539446-52539468 CTCACAGTTTCACATGGCTGAGG + Intergenic
1126844488 15:52746175-52746197 CTCACAGTTCCACATGGCTAGGG - Intergenic
1126906403 15:53372367-53372389 CTCACAGTTTCACATGGCCAGGG - Intergenic
1127043474 15:55002110-55002132 CTCACAGTTCCACATGGCTAGGG + Intergenic
1127179280 15:56397880-56397902 CTCACAGTTTCACATGGCTGGGG - Intronic
1127707598 15:61562484-61562506 CTGGGAGTCTCCCCAGGCTAAGG + Intergenic
1127977055 15:64005572-64005594 CCCAGAGTCCCTCATGCCTAAGG + Intronic
1128709991 15:69864554-69864576 CTCATAGTTCCACATGGCTAGGG + Intergenic
1130074557 15:80677517-80677539 CTCAGAGTCTACTCTGGCTTGGG + Intergenic
1130215106 15:81960692-81960714 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1130780866 15:87038800-87038822 CTCACAGTTTCGCATGGCTGGGG - Intergenic
1131590786 15:93746619-93746641 CTCACTGCCTCCCTTGGCTAGGG - Intergenic
1133473416 16:6097209-6097231 CTCACAGTTCCACATGGCTACGG - Intronic
1133666454 16:7972697-7972719 CTCACAGTCCCACATGGCTGGGG - Intergenic
1133685542 16:8162261-8162283 CACAGAGTCTCCAAAGGCTCAGG + Intergenic
1133831363 16:9326420-9326442 CTCACAGTTCCACATGGCTAGGG + Intergenic
1134235640 16:12463374-12463396 CTCACAGTTCCACATGGCTAAGG + Intronic
1134336346 16:13302975-13302997 CTCACAGTTTCGCATGGCTGGGG - Intergenic
1134566069 16:15252947-15252969 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1134601284 16:15535802-15535824 CTCACAGTTTCGCATGGCTGGGG + Intronic
1134736425 16:16503751-16503773 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1134931089 16:18208417-18208439 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1135784063 16:25332149-25332171 CTCACAGTTTCACATGGCTGTGG - Intergenic
1135807494 16:25556054-25556076 CTCAGGGCTTCCCTTGGCTAGGG - Intergenic
1135812894 16:25605757-25605779 CTCACAGTTCCACATGGCTAGGG - Intergenic
1135953508 16:26936936-26936958 CTCACAGTTCCACATGGCTAGGG - Intergenic
1137253123 16:46754531-46754553 CCCAGGGTATCCCATGGCGAAGG - Intronic
1137335727 16:47546887-47546909 CTCAGCGGGTCCCATGGCCATGG - Intronic
1137371445 16:47910224-47910246 CTCAGAGGGTCCCATGCCCATGG + Intergenic
1137680874 16:50343667-50343689 CTCAGAGGGTCCCATGCCCACGG + Intronic
1137907059 16:52333758-52333780 CTCAGAGGGTCCCATGTCCACGG + Intergenic
1137931904 16:52596637-52596659 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1138007322 16:53350165-53350187 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1138707559 16:58933096-58933118 CTCACAGTCCCACATGGCTGGGG + Intergenic
1138713222 16:58993031-58993053 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1138797223 16:59983493-59983515 CTGAGAGTCACCTATAGCTAGGG + Intergenic
1138823534 16:60290307-60290329 CTCAGAATTCCACATGGCTAGGG - Intergenic
1139188101 16:64831678-64831700 CTCACAGTTTCACATGGCTGGGG - Intergenic
1139621781 16:68150958-68150980 CTCACAGTCCCCCATGGCTGGGG - Intronic
1140165171 16:72543419-72543441 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1140247762 16:73266855-73266877 CTCACAGTTCCACATGGCTAGGG - Intergenic
1140255362 16:73331065-73331087 CTCACAGTTCCACATGGCTAGGG + Intergenic
1140583176 16:76255083-76255105 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1140772223 16:78215546-78215568 CTCACAGTTCCGCATGGCTAGGG - Intronic
1140867730 16:79078572-79078594 CTCAGATTCTCCTATGGCGAGGG - Intronic
1141349120 16:83276522-83276544 CTTACAGTTTCCCATGGCTGGGG + Intronic
1141439687 16:84021892-84021914 CGCAGAGTGTCACATGGCAAGGG + Intronic
1141554571 16:84828357-84828379 CTGAGTTTCTTCCATGGCTAGGG - Intronic
1143468394 17:7154598-7154620 CTCACAGTTTCACATGGCTGGGG + Intergenic
1144001495 17:11059321-11059343 CGCAGAGTCTCACATGGCGAGGG + Intergenic
1144281592 17:13732341-13732363 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1144434186 17:15224329-15224351 CTCACGGCTTCCCATGGCTAGGG + Intergenic
1144508659 17:15856344-15856366 CTCACAGTTTCACATGGCTGAGG - Intergenic
1145104883 17:20106722-20106744 CTCACAGTTCCACATGGCTAGGG - Intronic
1145172778 17:20673984-20674006 CTCACAGTTTCACATGGCTGAGG - Intergenic
1147139102 17:38451693-38451715 CCCAGAGTCTGACATGGCTGGGG + Intronic
1147477458 17:40725975-40725997 CTCACAGTTCCACATGGCTAGGG - Intergenic
1148623973 17:49054862-49054884 CTCAGACTCCCCCAGGGCAAAGG - Exonic
1148800831 17:50224705-50224727 CTCACAGTTTCACATGGCTGGGG + Intergenic
1149120426 17:53157346-53157368 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1149135438 17:53358660-53358682 CTCACAGTTCCACATGGCTAGGG - Intergenic
1149164028 17:53727986-53728008 CTCATAGTTTAGCATGGCTAGGG + Intergenic
1149189911 17:54049420-54049442 CTCACAGTCCCACATGGCTGGGG + Intergenic
1149363519 17:55917791-55917813 CTCAGAGTTCCACATGGCTAGGG - Intergenic
1149380333 17:56087235-56087257 ACCAGATTCACCCATGGCTAAGG - Intergenic
1150459160 17:65332870-65332892 CTCACAGTTCCCCATGGCTGGGG + Intergenic
1150964889 17:69956662-69956684 CTCACAGTCCCACATGGCTGGGG - Intergenic
1151014214 17:70535555-70535577 CTCACAGTTCCGCATGGCTAGGG + Intergenic
1151111988 17:71689395-71689417 CTCACAGTTGCACATGGCTAGGG + Intergenic
1151129816 17:71884944-71884966 CTCACAGTTTCACATGGCTGGGG - Intergenic
1151216779 17:72582529-72582551 CTCACAGTCCCACATGGCTGGGG - Intergenic
1151877536 17:76875468-76875490 CTCAGAGTCCAGCATGGCTGGGG - Intronic
1152159692 17:78659837-78659859 CTCACAGTTCCGCATGGCTAGGG + Intergenic
1152320146 17:79604177-79604199 CTCAGAACCTCCCATGAATAAGG + Intergenic
1203168486 17_GL000205v2_random:122403-122425 CTCACAGTTTCACATGGCTGGGG - Intergenic
1153085010 18:1275161-1275183 CTTACAGTTTCCCATGGCTGGGG - Intergenic
1153538005 18:6123573-6123595 CTCACAGTTTCACATGGCTGGGG - Intronic
1154048849 18:10933956-10933978 CTCACAGTTTCACATGGCTGGGG - Intronic
1154103402 18:11498374-11498396 CTCAGAGTTCCACATGACTAGGG - Intergenic
1154514928 18:15152744-15152766 CTCACAGTTTCACATGGCTGGGG + Intergenic
1154949029 18:21190346-21190368 CTCACAGTTCTCCATGGCTAGGG - Intergenic
1154980396 18:21498707-21498729 CTCTGAGTCAGCCATGGCTGGGG - Intronic
1155226415 18:23733340-23733362 CTCACAGTTCCACATGGCTAGGG + Intronic
1155505641 18:26530052-26530074 ATCAGAGTCTCCCAAGGGAATGG + Intronic
1155842834 18:30667849-30667871 GGCAGAGCTTCCCATGGCTATGG - Intergenic
1155857415 18:30850501-30850523 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
1155880423 18:31141071-31141093 CTTACAGTTTCACATGGCTAGGG - Intronic
1156227555 18:35124147-35124169 CTCACAGTTTCTCAGGGCTAGGG + Intronic
1156640804 18:39095344-39095366 CTCACAGTTTCGCATGGCTGGGG - Intergenic
1156684525 18:39628407-39628429 CTCACAGTTTCACATGGCTGGGG - Intergenic
1156955001 18:42951893-42951915 CTCACAGTTCCGCATGGCTAAGG + Intronic
1157284897 18:46371006-46371028 CTCACAGTTCCACATGGCTAGGG + Intronic
1157756933 18:50226940-50226962 TTCAGTGTCTCCCATGGGTCAGG - Intergenic
1157758899 18:50244430-50244452 CTCACAGTTTCACATGGCTGGGG - Intronic
1157877461 18:51287135-51287157 CTCACAGTTTCACATGGCTGGGG - Intergenic
1158105724 18:53882986-53883008 CTCACCGTCTCCCTTGGCTGGGG + Intergenic
1158130093 18:54142853-54142875 CTCAGAGTTCCGCATGGCTGAGG - Intergenic
1158226242 18:55204623-55204645 CTCACAGTTCCACATGGCTAGGG + Intergenic
1158247172 18:55445384-55445406 CTCATAGTTTCACATGGCTGGGG + Intronic
1158322619 18:56280098-56280120 CTCACAGTTCCACATGGCTAGGG - Intergenic
1158345142 18:56508681-56508703 CTCACAGTTTACCATGGCTGGGG - Intergenic
1158396447 18:57081899-57081921 CTGAGAGTCACCAAAGGCTATGG + Intergenic
1158639153 18:59188581-59188603 CTCACAGTTTCACATGGCTGGGG + Intergenic
1158781185 18:60653887-60653909 CTCAGTGTCTCCAGTGGCTGAGG - Intergenic
1158796355 18:60850700-60850722 CTCACAGTTTTACATGGCTAGGG + Intergenic
1159017209 18:63110897-63110919 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1159152197 18:64534930-64534952 CTCACAGTTCCACATGGCTAAGG - Intergenic
1159175708 18:64831145-64831167 CTCACAGTCTCGCTTGGCTGGGG + Intergenic
1159534586 18:69699911-69699933 CTCACAGTCCCACGTGGCTAAGG + Intronic
1159562124 18:70007172-70007194 CTCAGAGCTTCCCTTGGCTAAGG - Intronic
1159838698 18:73371746-73371768 CTCACAGTTCCACATGGCTAGGG - Intergenic
1159841263 18:73401707-73401729 CTCACAGTTTACCATAGCTAGGG - Intergenic
1160292086 18:77604106-77604128 CTCAGAGTCCCACTTGGCTGGGG + Intergenic
1160382765 18:78473289-78473311 CTCAGAGATCCACATGGCTAGGG - Intergenic
1160466718 18:79083633-79083655 CTCAGTGCTTCCCTTGGCTAGGG + Intronic
1160599232 18:79999989-80000011 CTCACAGTTTCACATGGCTGGGG - Intronic
1161359916 19:3842326-3842348 CTCAGGGTCTCTCGTTGCTATGG - Intronic
1162332005 19:10035854-10035876 CTCATAGTCTCCCATGAATTGGG - Intergenic
1162607459 19:11720948-11720970 CACAGAGCCTTCCATGGTTAAGG + Intergenic
1163724229 19:18913446-18913468 CCCAGGGTCTCCCCTGGCCAGGG - Intronic
1164129640 19:22350036-22350058 CTCACAGTTCCACATGGCTAAGG + Intergenic
1164367599 19:27602731-27602753 CTCAGAGGGTCCCATGCCCATGG - Intergenic
1164934591 19:32201094-32201116 CACAGAGTGTCCCATGGTGAGGG - Intergenic
1165194008 19:34087036-34087058 CTCACAGTTTCACATGGCTGGGG - Intergenic
1165283717 19:34819623-34819645 CTAATAGTCTGACATGGCTATGG + Intergenic
1166968697 19:46547469-46547491 CTCACAGTTCCACATGGCTAGGG - Intronic
1167204826 19:48093987-48094009 CTCACAGTTTCACATGGCTGGGG - Intronic
1167964739 19:53133978-53134000 CTCACAGTTCCGCATGGCTAGGG - Intronic
1167974195 19:53210531-53210553 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
925338374 2:3115267-3115289 CTCACAGTCCCACATGGCTGGGG + Intergenic
925459007 2:4043800-4043822 CTCACAGTCCCACATGGCTGGGG - Intergenic
925516487 2:4689301-4689323 CTCAGGATATCCCATGGCTAGGG - Intergenic
925562967 2:5218133-5218155 CTCACAGTTTCACATGGCTGGGG - Intergenic
925633380 2:5917463-5917485 CTCACAGTTTCACATGGCTGGGG - Intergenic
925642840 2:6003473-6003495 CTCACAGTTTCACATGGCTGGGG - Intergenic
925646386 2:6041479-6041501 CTCACAGTTTCACATGGCTGGGG - Intergenic
925669318 2:6294090-6294112 CTCAGAGTTCCACATGGCCAGGG - Intergenic
925830885 2:7894463-7894485 CTCAGAGTTCCACATGGCTGGGG - Intergenic
925897436 2:8483525-8483547 CTCACAGTCCCACATGGCTAGGG + Intergenic
926392104 2:12403849-12403871 CTCACAGTTTACCATGGCTGGGG - Intergenic
926445871 2:12942359-12942381 CTCACAGTTTTCCATGGCTGGGG + Intergenic
926469606 2:13237735-13237757 CTCACAGTTTCACATGGCTGGGG + Intergenic
926475597 2:13317992-13318014 CTCACAGTTCCCCATGGCTGAGG - Intergenic
926484151 2:13434056-13434078 CTCAGAGTTCCACATGGCTGGGG + Intergenic
926570324 2:14522349-14522371 CTCACAGTTTCACATGGCTGGGG - Intergenic
926631106 2:15136938-15136960 CTCACAGTTTCACATGGCTGGGG - Intergenic
926890199 2:17633062-17633084 CTCACAGTGCCACATGGCTAAGG + Intronic
926939282 2:18118138-18118160 CTCACAGTTTCACATGGCTGGGG + Intronic
927182731 2:20458518-20458540 CTCATAGCTTCCCTTGGCTAGGG - Intergenic
927231682 2:20830126-20830148 CTCACAGTTTCACATGGCTGGGG - Intergenic
927267066 2:21162882-21162904 CTCAGAGTTTCACATGGCTAGGG + Intergenic
927342022 2:21993307-21993329 CTCAGAGTTCCACATGGCTAGGG + Intergenic
927409110 2:22805183-22805205 CTCACAGTTCCACATGGCTAGGG + Intergenic
927423232 2:22954461-22954483 CTCACAGTTCCACATGGCTAGGG - Intergenic
927424600 2:22968166-22968188 CTCACAGTTCCGCATGGCTAGGG + Intergenic
927447005 2:23171889-23171911 CTCAGAGGGTCCCATGCCCACGG + Intergenic
927660922 2:24991992-24992014 CTCACAGTTCCCCATGGCTGGGG - Intergenic
928181756 2:29072998-29073020 CTCAGGGGCTCCTATGGCAAAGG - Exonic
928250074 2:29668796-29668818 CTCACAGTTTCACATGGCTGCGG + Intronic
928522726 2:32106237-32106259 CTCAGAGGGTCCCATGCCAACGG - Intronic
928721430 2:34125814-34125836 CTCACAGTTTCACATGGCTGGGG + Intergenic
928728144 2:34199265-34199287 CTCACAGTTCCACATGGCTAGGG - Intergenic
928749231 2:34452817-34452839 CTCATAGTCACACATGGCTGGGG + Intergenic
928768049 2:34671310-34671332 CTCACAGTCGCACATGGCTGAGG + Intergenic
928797147 2:35035438-35035460 CTAACAGTTACCCATGGCTAGGG + Intergenic
928864972 2:35906667-35906689 CTCAGAGGGTCCCATGCCCACGG - Intergenic
929090036 2:38206898-38206920 CTCATAGTTTCTCATGGCTGGGG - Intergenic
929668072 2:43849283-43849305 CTCAGAGTTCCTCATGGCTGGGG + Intronic
929815527 2:45228147-45228169 CTCACAGTTTCACGTGGCTAGGG - Intergenic
929837948 2:45425746-45425768 CTCACAGCTTCCCTTGGCTAGGG - Intronic
930012828 2:46950505-46950527 CCGAGAGCCTCCCATGGTTAAGG - Exonic
930473116 2:51845744-51845766 CTCACAGTTCCCCATGGCTGGGG - Intergenic
930480493 2:51942955-51942977 CTCACAGTTTCTCATGGCTGGGG - Intergenic
930493452 2:52107226-52107248 CTCACAGTTTCACATAGCTAGGG + Intergenic
930521446 2:52471834-52471856 CTCACAGTTTTGCATGGCTAGGG - Intergenic
930904419 2:56549215-56549237 CTCACAGTTTCACATGGCTGGGG + Intergenic
930921913 2:56766081-56766103 CTCACAGTTCCACATGGCTAGGG - Intergenic
931100830 2:58998962-58998984 CTCACAGTTCCTCATGGCTAGGG - Intergenic
931109729 2:59097872-59097894 CTCACAATCCCACATGGCTAGGG + Intergenic
931538595 2:63304496-63304518 CTCACAGCTTCCCTTGGCTAGGG - Intronic
931984214 2:67726131-67726153 CCCAGAGTTTGCCCTGGCTATGG - Intergenic
932421591 2:71604497-71604519 CTCATGGGCTCCCATGGCCAGGG - Intronic
932574269 2:72954284-72954306 CTAAGAGTCTCCCAGGGCCAGGG - Intronic
932849405 2:75170361-75170383 CTCACAGTTCCACATGGCTAGGG - Intronic
932912410 2:75819293-75819315 CTCACAGTTTCACATGGCTGAGG + Intergenic
932923083 2:75940379-75940401 CTCACAGTTCCACATGGCTAGGG - Intergenic
933005211 2:76983555-76983577 CTCACAGTTTCACATGGCTGGGG - Intronic
933113669 2:78437745-78437767 CTCATAGTTTCACATGGCTGAGG - Intergenic
933425701 2:82109654-82109676 CTCACAGTTTCACATGGCTGGGG + Intergenic
933781547 2:85805779-85805801 CTCACAGTTTCACATGGCTGAGG + Intergenic
934673065 2:96228927-96228949 CACAGGGTGTCCCATGGCAAGGG + Intergenic
934699225 2:96425817-96425839 CTCAGAGTTCCACATGGCTGGGG + Intergenic
935325769 2:101935582-101935604 CTCACACCCTCCCTTGGCTAGGG - Intergenic
935437166 2:103047228-103047250 CTCATAGTTTCACATGGCTGGGG + Intergenic
935855834 2:107271851-107271873 CTCACAGTTTCGCATGGCTAGGG - Intergenic
936152784 2:110030800-110030822 CTCACACTCTCCCATGGCTGGGG + Intergenic
936191896 2:110340612-110340634 CTCACACTCTCCCATGGCTGGGG - Intergenic
936430412 2:112457812-112457834 CTCACAGTTTCACATGGCTGGGG + Intergenic
936633159 2:114226376-114226398 CTCACAGTTCCACATGGCTAGGG - Intergenic
936689713 2:114872176-114872198 CTCACAGTTTCACATGGCTATGG + Intronic
936866602 2:117081897-117081919 CTCACAGTTTCACATGGCTGGGG + Intergenic
936920312 2:117681807-117681829 CTCACAGTTCCACATGGCTAGGG - Intergenic
936969457 2:118163469-118163491 CTCAGAGTTCCACATGGCTGGGG - Intergenic
937491499 2:122372703-122372725 CTCACAGTCCCACATGGCTGGGG + Intergenic
937510209 2:122587085-122587107 CTCACAGTTTCACATGTCTAGGG + Intergenic
937573448 2:123391587-123391609 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
937658456 2:124403795-124403817 CTCACAGTTCCACATGGCTAGGG + Intronic
937772345 2:125735102-125735124 CTCACAGTTCCACATGGCTAGGG + Intergenic
937807220 2:126160695-126160717 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
937983753 2:127629383-127629405 CCGAGGGTCTCCCAGGGCTAGGG + Intronic
938515188 2:131997510-131997532 CTCACAGTTTCACATGGCTGGGG + Intergenic
938745838 2:134277350-134277372 CTCAGAGTTCCACATGGCTGGGG + Intronic
938798518 2:134738822-134738844 CTGAGAGTGTCCCATGGCCATGG + Intergenic
938827563 2:135020862-135020884 CTCAGAGTTCCACATGGCTGGGG - Intronic
938874492 2:135518484-135518506 CTCACAGCTTCCCTTGGCTAAGG + Intronic
938978075 2:136498684-136498706 CTCACAGTTTCACATGGCTGGGG + Intergenic
939116960 2:138071467-138071489 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
939252842 2:139705345-139705367 CTCACAGTTCCACATGGCTAGGG + Intergenic
939279164 2:140039811-140039833 CTCACAGTTTCACATGGCTGTGG + Intergenic
939391044 2:141570335-141570357 CTCACTGCCTCCCTTGGCTAGGG - Intronic
939456337 2:142441653-142441675 CTCACAGTTTCTCATGGCTGGGG - Intergenic
939471611 2:142629498-142629520 CTCACAGTTTCCCATGGCTGAGG + Intergenic
939504766 2:143031856-143031878 CTCACAGTTTCACATGGCTGGGG + Intronic
939667679 2:144970505-144970527 CTTAAAGTTTCACATGGCTAGGG + Intergenic
940220631 2:151347779-151347801 CTCACAGTTCTCCATGGCTAGGG + Intergenic
940408630 2:153334805-153334827 CTCATAGTCTCCCATGCTTGAGG + Intergenic
940610273 2:155981253-155981275 CTCAAAGTTTCACATGGCTGGGG + Intergenic
940812627 2:158262577-158262599 CTCAGAGTTCTGCATGGCTAGGG + Intronic
940825759 2:158410019-158410041 CTCACAGTTTCACATGGCTGGGG - Intronic
940929522 2:159410570-159410592 CTCACAGTTTCGCATGGCTGGGG - Intronic
940998949 2:160180901-160180923 CTCACAGCTTCCCTTGGCTAGGG - Intronic
941137462 2:161735046-161735068 CTCACAGTTTCTCATGGCTTGGG - Intronic
941488374 2:166110983-166111005 CTCACAGTTCCACATGGCTAGGG - Intronic
941518782 2:166511784-166511806 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
941651047 2:168093319-168093341 CTCACAGTTTCACATGGCTAGGG + Intronic
941682403 2:168413271-168413293 CTCACAGCCTCCCTTGGCTAGGG + Intergenic
941682483 2:168414143-168414165 CTCACAGTTCCACATGGCTAGGG + Intergenic
941724574 2:168847392-168847414 TTCAGAGGCTCCCAGGTCTAGGG - Intronic
941895833 2:170628322-170628344 CTCAGAGGGTCCCATGCCCACGG - Intronic
942376179 2:175340008-175340030 CTCACTGCCTCCCTTGGCTAGGG + Intergenic
942402447 2:175617527-175617549 CTCACAGTTTCACATGGCTAGGG + Intergenic
942660076 2:178254921-178254943 CTCACAGTTTCACATGGCTGGGG + Intronic
942904861 2:181167965-181167987 CTCAGAGCTTCATATGGCTAGGG + Intergenic
942926067 2:181433920-181433942 CTCACAGTTCCACATGGCTAGGG - Intergenic
942953767 2:181750765-181750787 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
942975752 2:182015371-182015393 CTCACAGTTCCACATGGCTAGGG - Intronic
943315915 2:186387019-186387041 TTCACAGTTTCCCATGACTAGGG + Intergenic
943416473 2:187612445-187612467 CTCACAGTTCCACATGGCTAGGG + Intergenic
943628458 2:190224120-190224142 CTCAGAGGGTCCCATGCCCACGG + Intronic
943926173 2:193783166-193783188 CTCACAGTTTCACATGGCTAGGG - Intergenic
943957275 2:194208151-194208173 CTCACAGTTCCACATGGCTAGGG + Intergenic
944011590 2:194980472-194980494 CTCACAGTTTCACATGGCTGGGG + Intergenic
944021998 2:195115748-195115770 ATCACAGTTCCCCATGGCTAGGG - Intergenic
944252180 2:197589350-197589372 CTCAGAGTTCCTCATGGCTGAGG - Intronic
944504903 2:200401256-200401278 CTCAGGGTCTCTCATGGAGATGG - Intronic
944613013 2:201430604-201430626 CTCAGAGGGTCCCATGCCCACGG - Intronic
944907565 2:204277867-204277889 CTCACAGTCCCACATGGCTGGGG + Intergenic
945207163 2:207344371-207344393 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
945409100 2:209488197-209488219 CTCAGGGCTTCCCTTGGCTAGGG - Intronic
945475629 2:210278977-210278999 CTCACAGTTCCACATGGCTAGGG + Intergenic
945589392 2:211710845-211710867 CTCACAGTCCCACATGGCTGGGG - Intronic
945671143 2:212804171-212804193 CTCACAGTTTCACATGGCTAGGG + Intergenic
945860975 2:215121888-215121910 CTCACAGTTTCACATGGCTGGGG - Intronic
946150108 2:217759147-217759169 CTCACAGTTTCACATGGCTGGGG + Intergenic
946629138 2:221647189-221647211 CTCACAGTTTCACATGGCTGGGG - Intergenic
946656463 2:221953221-221953243 CTCACAGTTCCACATGGCTAGGG - Intergenic
946769237 2:223071572-223071594 CTCACAGTTCCACATGGCTAGGG + Intronic
946858466 2:223977091-223977113 CTCACAGTTTCACATGGCTAGGG - Intronic
946912921 2:224485046-224485068 CTCAGGGCTTCCCTTGGCTAGGG - Intronic
947042403 2:225938298-225938320 CTCACAGTTCCACATGGCTAGGG - Intergenic
947043178 2:225948116-225948138 CTCACAGTTCCACATGGCTAGGG - Intergenic
947045497 2:225978325-225978347 CTCACAGTCACACATGGCTGGGG + Intergenic
947070121 2:226279769-226279791 CTCATAGTTTCACATGGCTGGGG - Intergenic
947085980 2:226453839-226453861 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
947101435 2:226625437-226625459 CTCAGAGTTCCACATGGCTGGGG + Intergenic
947126455 2:226873929-226873951 CTCACAGTTCCCCATGGCTGAGG + Intronic
947154926 2:227152978-227153000 CTCACAGTTCCACATGGCTAGGG + Intronic
947518421 2:230826724-230826746 CTCACAGTCCCACATGGCTGGGG - Intergenic
947518790 2:230828630-230828652 CTGGGAGTCTCCCTTGGGTAGGG - Intergenic
947964126 2:234264922-234264944 CTCACAGTTTCACATGGCTGAGG + Intergenic
948016862 2:234698204-234698226 CTCACAGTTCCACATGGCTAGGG + Intergenic
948271813 2:236680112-236680134 CACAGAGTGTTCCATGGCAAGGG - Intergenic
948450409 2:238066823-238066845 CTCACAGTTTCCCATGGCTGGGG + Intronic
948760614 2:240188227-240188249 CTCACAGTTCCACATGGCTAGGG - Intergenic
949039077 2:241837603-241837625 CTCACAGTTCCCCATGGCTGGGG - Intergenic
1169018388 20:2310188-2310210 CTCAGAGTCGGCCATGACGAAGG + Exonic
1169307100 20:4501607-4501629 CTCAGAGGGTCCCATGTCCACGG - Intergenic
1169730593 20:8781690-8781712 CTCATAGTTTCACATGGCTGGGG + Intronic
1169848007 20:10016429-10016451 CTCACAGTTTCGCATGGCTGGGG + Intronic
1170065225 20:12303451-12303473 CTCAGAGCTTCCCAAGGCCATGG - Intergenic
1170133839 20:13052286-13052308 CTCAGGGCTTCCCTTGGCTAGGG - Intronic
1170167970 20:13381303-13381325 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1170399991 20:15971502-15971524 CTCACAGTTCCACATGGCTAGGG - Intronic
1170643720 20:18178465-18178487 CTTAGAGTCCCACCTGGCTAGGG + Intronic
1170695506 20:18654361-18654383 CTCATAGTTCCACATGGCTAGGG - Intronic
1170963133 20:21043165-21043187 CTCACAGTTCCCCATGGCTGGGG - Intergenic
1171148387 20:22805414-22805436 CTCAGATTCTCCCTTGCCTGTGG - Intergenic
1171441325 20:25165850-25165872 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1172600267 20:36178326-36178348 CTCAGAGCCTCCCAAGGGTAGGG - Intronic
1173062989 20:39680004-39680026 CTCAGAGTGTAGCATGGCTGGGG + Intergenic
1173098273 20:40059447-40059469 CTCACAGTTCCACATGGCTAGGG - Intergenic
1173177349 20:40774331-40774353 CTCATAGTCCCTCATGGCTGAGG + Intergenic
1173457404 20:43214693-43214715 CTCAGAGTTCCACATGGCTAGGG - Intergenic
1173532509 20:43781186-43781208 CTCACAGTTTCCCATGGCTGGGG - Intergenic
1173679163 20:44864453-44864475 CTCACAGTTCCACATGGCTAGGG + Intergenic
1174116419 20:48229549-48229571 CTCACAGTTTCACATGGCTGGGG + Intergenic
1174517791 20:51106449-51106471 CTCACAGTTTCACATGGCTGGGG + Intergenic
1174661807 20:52220250-52220272 CTCACAGTTCCCCATGGCTAGGG + Intergenic
1174725462 20:52856976-52856998 CTCACAGTTCCACATGGCTAGGG - Intergenic
1175724123 20:61305626-61305648 CTCAGAGCTTCCCAGGGCTTTGG + Intronic
1175879102 20:62246379-62246401 CTTAGACTCTCCCATGGCACTGG - Intronic
1176148693 20:63577648-63577670 CTTAGAGTCTTCCATGGCACAGG - Intergenic
1176358777 21:5974810-5974832 CTTACAGTTTCACATGGCTAGGG - Intergenic
1176403275 21:6336732-6336754 CTCACAGTTTCACATGGCTGGGG + Intergenic
1176433882 21:6652372-6652394 CTCACAGTTTCACATGGCTGGGG - Intergenic
1176778601 21:13165401-13165423 CTCACAGTTTCACATGGCTGGGG - Intergenic
1176915554 21:14621510-14621532 CTCAGAGGATCCCATGCCCATGG + Intronic
1177201643 21:17963414-17963436 CTCATAGTTCCACATGGCTAGGG + Intronic
1177289856 21:19096912-19096934 CTCAGAGTTTTGCATGGCTGGGG - Intergenic
1177351127 21:19943615-19943637 CTCAGAGTTTCCCATATCTGGGG + Intergenic
1177356539 21:20015267-20015289 CTCACAGTTCCACATGGCTAGGG - Intergenic
1177387205 21:20424094-20424116 CTCAAAGTTCCACATGGCTAGGG + Intergenic
1177484313 21:21737247-21737269 CTCACAGTTCCACATGGCTAGGG + Intergenic
1177529176 21:22337912-22337934 CTCACAGTTTCACATGGCTGGGG - Intergenic
1177693102 21:24536083-24536105 CTCACAGTTTCACATGGCTCAGG + Intergenic
1177719311 21:24883843-24883865 CTCACAGTTTCACATGGCTGGGG - Intergenic
1177893567 21:26835258-26835280 CTCACAGTTCCACATGGCTAGGG - Intergenic
1177898694 21:26886400-26886422 CTCAGAGTTCTGCATGGCTAGGG - Intergenic
1177927848 21:27241467-27241489 CTCAGAGTTTCACATGGCTGGGG + Intergenic
1177959913 21:27650820-27650842 CTCACAGTTTCACATGGCTGAGG + Intergenic
1177976226 21:27854414-27854436 CTCACAGTTTCACATGGCTGGGG - Intergenic
1178007047 21:28233961-28233983 CTCACAGATTCCCTTGGCTAGGG - Intergenic
1178061371 21:28856709-28856731 CTCATTGTATCCCTTGGCTAGGG - Intergenic
1178216370 21:30603734-30603756 CTCACAGTTTCACATGGCTGGGG - Intergenic
1178266625 21:31148438-31148460 CTCACAGTCCCTCATGGCTGGGG - Intronic
1178345186 21:31819999-31820021 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1178365259 21:31984912-31984934 CTCACAGTTTCACATGGCTGGGG + Intronic
1178540128 21:33442401-33442423 CTCAGAGCCACCCGTTGCTAAGG + Intronic
1178630134 21:34252323-34252345 CTCACAGTTTCACATGGCTGGGG - Intergenic
1178813994 21:35910595-35910617 CTCACAGTTCCACATGGCTAGGG - Intronic
1179142517 21:38738582-38738604 CTCACAGTTTCACATGGCTGGGG - Intergenic
1179346491 21:40562388-40562410 CTCACAGTTCCACATGGCTAGGG - Intronic
1179356851 21:40667803-40667825 CTCACAGTTTCACATGGCTGGGG - Intronic
1179441884 21:41400580-41400602 CTCACAGTTCCACATGGCTAGGG + Intronic
1179764741 21:43563740-43563762 CTTACAGTTTCACATGGCTAGGG + Intronic
1179773521 21:43643274-43643296 CTCCGAGACTCTCATCGCTATGG + Intronic
1179964067 21:44790694-44790716 CTCACAGTTCCACATGGCTAGGG - Intronic
1181341944 22:22188196-22188218 CTCAGAGGGTCCCACGCCTACGG + Intergenic
1182302939 22:29348682-29348704 TTCAGTGTCTGCCATGACTATGG + Intronic
1183021558 22:35031173-35031195 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1183040001 22:35170876-35170898 CTCAGAGACTCCCCTGGCTGTGG + Intergenic
1184157450 22:42677458-42677480 CTCACAGTTTCACATAGCTAGGG - Intergenic
1184752288 22:46493844-46493866 CTCACAGTCCCACATGGCTGGGG - Intronic
1184929375 22:47669780-47669802 CTCACAGTTCCACATGGCTAGGG + Intergenic
1184948754 22:47823895-47823917 CTCACAGTTTCACATGGCTAGGG - Intergenic
1185192147 22:49445664-49445686 CTCACAGTCCCACATGGCTGGGG + Intronic
949094133 3:65644-65666 CTCAGAGTTCCACATGGCTGGGG - Intergenic
949238308 3:1837925-1837947 CTCACAGTTTCACATGGCTGAGG - Intergenic
949461164 3:4296461-4296483 CTCACAGTTTCACATGGCTGGGG + Intronic
949486066 3:4539792-4539814 CACAGGGTATCCCATGGCGATGG - Intronic
949585228 3:5430789-5430811 CTCACAGTTTTCCATGGCTGGGG + Intergenic
949657357 3:6235903-6235925 CTCACAGTTTCACATGGCTGGGG - Intergenic
949760859 3:7468874-7468896 CTCACAGTTCCACATGGCTAGGG - Intronic
949816900 3:8068400-8068422 CTCAGAGGGTCCCATGCCCACGG - Intergenic
949934555 3:9106740-9106762 CTCACTGTCCCACATGGCTAGGG - Intronic
950564380 3:13758306-13758328 CTCAGACTCACCCATGCCTGTGG - Intergenic
950867387 3:16200026-16200048 CTCACAGTTTCGCATGGCTGGGG + Intronic
950990817 3:17435393-17435415 CTCACAGTTTCGCATGGCTGGGG + Intronic
951615089 3:24533369-24533391 CTCACAGTTTCACATGGCTGGGG - Intergenic
951629182 3:24699696-24699718 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
951795551 3:26534224-26534246 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
951928468 3:27936538-27936560 CTCACAGTTCCACATGGCTAGGG - Intergenic
952029167 3:29120221-29120243 GGCAGAGTTTCCCAAGGCTAGGG + Intergenic
952198619 3:31102164-31102186 CTCACAGTTCCACATGGCTAGGG + Intergenic
952291741 3:32023405-32023427 CTCACAGTTTCACATGGCTGGGG - Intronic
953047167 3:39304441-39304463 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
953073997 3:39551118-39551140 CTCAGGGTTTCCCTTGGCTAGGG - Intergenic
953299839 3:41762531-41762553 CTCACAGTTCCACATGGCTAGGG + Intronic
953729450 3:45434189-45434211 ATCAGAGTCTCCTAAGGCAAGGG - Intronic
953820345 3:46202823-46202845 ATCAGTGTCTCCCATGGCTTAGG + Exonic
954148043 3:48643970-48643992 CCCAGAGTCTCCCATGGCCTGGG - Intronic
954279323 3:49564808-49564830 CACAGGGGCTGCCATGGCTAGGG - Intronic
954496347 3:50967592-50967614 CTCACAGTTTCGCATGGTTAGGG + Intronic
955834947 3:63044547-63044569 CTCACAGTTTCACATGGCTGGGG + Intergenic
956044134 3:65177215-65177237 CTCACAGTCCCACATGGCTGAGG + Intergenic
956359130 3:68427959-68427981 CTCATAGTTTCACATGGCTGAGG - Intronic
956375266 3:68607750-68607772 CTCACAGTTTCACATGGCTGGGG + Intergenic
956546758 3:70411795-70411817 CTCACAGTTTCACATGGCTGGGG - Intergenic
956586569 3:70871479-70871501 CTCAGAGTCCCACATGGCTGGGG - Intergenic
956591820 3:70923437-70923459 CTCAGAGTTCCACATGGCTGGGG - Intergenic
956909606 3:73803866-73803888 CTCAGAGTTCCACATGGCTGGGG - Intergenic
957012785 3:75027483-75027505 CTCACAGTTCCACATGGCTAGGG + Intergenic
957256683 3:77845603-77845625 CTCATGGCTTCCCATGGCTAGGG + Intergenic
957584420 3:82115086-82115108 CTCACTGCCTCCCTTGGCTAGGG + Intergenic
957630158 3:82707603-82707625 CTCAGAGCCTCCCTTGGCTGAGG + Intergenic
957695665 3:83635711-83635733 CTCATGGTTTCCCTTGGCTAGGG - Intergenic
957806313 3:85153422-85153444 CTCAGAGGGTCCCATGCCAACGG + Intronic
957925784 3:86809269-86809291 CTCACAGTTTCACATGGCTCGGG - Intergenic
957993617 3:87659605-87659627 CTCACAGTTTCACATGGCTTGGG - Intergenic
958023336 3:88022320-88022342 CTCACAGTTCCCCATGGCTGTGG + Intergenic
958583677 3:96059189-96059211 CTCACAGTTGCACATGGCTAGGG + Intergenic
959017596 3:101153242-101153264 CTCACAGTTCCACATGGCTAGGG - Intergenic
959175127 3:102898698-102898720 CTCAGAGTTCCACATGGCTGGGG - Intergenic
959247038 3:103884391-103884413 CTCACAGTTTCGCATGGCTGGGG + Intergenic
959345646 3:105191403-105191425 CTCACAGCTTCCCTTGGCTATGG + Intergenic
959405150 3:105952657-105952679 CTCACAGTTCCGCATGGCTAGGG + Intergenic
959732267 3:109618250-109618272 CTCACAGTTTCACATGGCTGGGG + Intergenic
959818651 3:110705189-110705211 CTCACAGTTTCACATGGCTAGGG + Intergenic
959883608 3:111474037-111474059 CTCACAGCCTCCCTTGGCTGGGG + Intronic
960055747 3:113275195-113275217 CTCAGAATCTGTCATGGCTTGGG + Intronic
960226973 3:115179838-115179860 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
960436510 3:117633460-117633482 CTCAGAGGCAGCCATGGCGATGG + Intergenic
960454413 3:117852941-117852963 CTCACAGTCTCACATGGCTGGGG + Intergenic
960461978 3:117947238-117947260 CTCACAGTTTTGCATGGCTAGGG + Intergenic
960760148 3:121064199-121064221 CTCACAGCTTCCCTTGGCTAAGG + Intronic
960813333 3:121647356-121647378 CCCAAAGCATCCCATGGCTATGG - Exonic
961116298 3:124332992-124333014 CTCACAGTTTCACATGGCCATGG + Intronic
961499651 3:127323260-127323282 CTCAGATTCTTCTATGGCCATGG - Intergenic
962106203 3:132392753-132392775 CTCACAGTCCCACATGGCTGGGG + Intergenic
962234983 3:133700008-133700030 CTCTGAGTCCCCCAGTGCTAAGG - Intergenic
962554095 3:136528355-136528377 CTCAGAGGGTCCCATGCCCACGG - Intronic
962646257 3:137444098-137444120 CTCACAGTTCCACATGGCTAGGG + Intergenic
962778839 3:138691663-138691685 CTCACAGTTCCACATGGCTAGGG - Intronic
962843070 3:139252738-139252760 CTCTGTGTTTCCCATGGCTCAGG - Intronic
963014033 3:140803513-140803535 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
963229032 3:142891354-142891376 CTCACAGTTTCACATGGCTGGGG + Intergenic
963255536 3:143140873-143140895 CTCACAGTTCCGCATGGCTAGGG - Intergenic
963375317 3:144456953-144456975 CTCACAGTTCCACATGGCTAGGG - Intergenic
963474975 3:145793525-145793547 CTTAGAGTATCACATGGCTGGGG + Intergenic
963528230 3:146440550-146440572 CTCAGAGGGTCCCATGCCCATGG - Intronic
963531307 3:146476312-146476334 CTCAGCGCCTCCCTTGGCTGGGG - Intronic
963564895 3:146916804-146916826 CTCACAGTTTCACATGGCTGGGG - Intergenic
963898600 3:150712049-150712071 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
963899455 3:150720170-150720192 CTCACAGTTCCACATGGCTAAGG + Intergenic
964090694 3:152873132-152873154 CTCACAGTTTCACATGGCTGGGG + Intergenic
964500213 3:157340388-157340410 CTCAGAGGGTCCCATGCCCATGG + Intronic
964675889 3:159279347-159279369 CTCACAGTTTCACATGGCTGGGG - Intronic
965018063 3:163186647-163186669 CTCACAGTTCCACATGGCTAGGG + Intergenic
965066782 3:163859066-163859088 CTCACAGTTCCACATGGCTAGGG - Intergenic
965137251 3:164787159-164787181 CTCAGAGGGTCCCATGCCCACGG + Intergenic
965198472 3:165628165-165628187 CTCACAGTTTCACATGGCTGGGG - Intergenic
965230024 3:166038522-166038544 CTCACAGATTCACATGGCTAGGG - Intergenic
965301669 3:167012418-167012440 CTCACAGTGTCCCATGGCTGGGG + Intergenic
965387061 3:168057426-168057448 CTCACAGTTCCGCATGGCTAGGG + Intronic
965666347 3:171097686-171097708 CTCACAGTTCCACATGGCTAGGG - Intronic
965880380 3:173382064-173382086 CTCAGGGCTTCCCTTGGCTAGGG - Intergenic
966059351 3:175735524-175735546 CTCACAGTTTCACATGGCTGGGG + Intronic
966309338 3:178576259-178576281 CTCACAGCTTCCCTTGGCTAGGG - Intronic
966643459 3:182216274-182216296 CTCACAGTCCCACATGGCTGGGG + Intergenic
966760809 3:183417773-183417795 CTCACAGTTCCACATGGCTAAGG + Intronic
966797055 3:183725481-183725503 CTCACAGTGCCACATGGCTAGGG + Intronic
967070974 3:185961932-185961954 CTCACAGTTTCACATGGCTAGGG - Intergenic
967634869 3:191789937-191789959 CTCACAGTTTCACATGGCTGGGG + Intergenic
967635132 3:191791884-191791906 CTCACAGTTCCACATGGCTAGGG + Intergenic
968439889 4:617897-617919 CTATGAGTCACCCCTGGCTATGG + Intergenic
968632868 4:1661224-1661246 CTCACAGGCTCCCACGGCCATGG + Intronic
968892699 4:3379594-3379616 CTCACAGTTTCACATGGCTGGGG + Intronic
968892974 4:3381488-3381510 CTCACAGTTCCACATGGCTAGGG + Intronic
968934024 4:3600594-3600616 CTCACAGCCTCCCAGGGCTGAGG + Intergenic
968991250 4:3914289-3914311 CTCACAGTTCCCCATGGTTAAGG - Intergenic
969107231 4:4816827-4816849 CTCACAGTTTTGCATGGCTAGGG - Intergenic
969146432 4:5128002-5128024 CTCACAGTCCCACATGGCTGGGG - Intronic
969852313 4:9969640-9969662 CTCACAGTTCCCCATGGCTGGGG + Intronic
969904559 4:10382099-10382121 CTCAGAGTTCCACATGGCTGGGG - Intergenic
969915982 4:10492174-10492196 CTCAGAGTCTCCCATGGCTAGGG + Intronic
970055754 4:11970111-11970133 CTCACAGTTTCACATGGCTGGGG - Intergenic
970077025 4:12234156-12234178 CTCATAGTTCCACATGGCTAGGG - Intergenic
970217739 4:13777404-13777426 CTCACAGTTCCCCATGGCTGGGG + Intergenic
970233243 4:13932730-13932752 CTCACAGTTTCACATGGCTGGGG + Intergenic
970261929 4:14233989-14234011 CTCACAGTTTCACATGGCTGGGG - Intergenic
970266019 4:14287222-14287244 CTCACAGTTCCACATGGCTAGGG + Intergenic
970357295 4:15268621-15268643 CTCACAGTTTCACATGGCTGGGG - Intergenic
970482489 4:16490744-16490766 CTCACAGTTTAGCATGGCTAGGG + Intergenic
970634458 4:17992148-17992170 CTCACAGTTCCACATGGCTAGGG + Intronic
970788373 4:19827689-19827711 CTCACAGTTTCACATGGCTAGGG - Intergenic
970808089 4:20059721-20059743 CTCACAGTTTCACATGGCTGGGG + Intergenic
970818827 4:20189787-20189809 CTCAGAGTTCAGCATGGCTAGGG - Intergenic
970851006 4:20603109-20603131 CTCACAGTTCCACATGGCTAGGG + Intronic
970862696 4:20722100-20722122 CTCAGAGAGTCCCATGCCCATGG - Intronic
971042760 4:22772913-22772935 CTCACAGTTTCACATGGCTGGGG + Intergenic
971217678 4:24676076-24676098 CTCACAGTTTCACATGGCTAGGG + Intergenic
971274469 4:25182661-25182683 CTCACAGTTTCCTATGGCTGGGG - Intronic
971430128 4:26556748-26556770 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
971430251 4:26557811-26557833 CTCACAGTTTCGCATGGCTGAGG + Intergenic
971456091 4:26845688-26845710 CTCACAGTCCCCCATGGCTGGGG + Intergenic
971487134 4:27171753-27171775 CTCACAGTTCCACATGGCTAGGG - Intergenic
971534358 4:27730170-27730192 CTCACAGTTTCACATGGCTGGGG + Intergenic
971728409 4:30344202-30344224 CTCACAGTTTCACATGGCTGAGG + Intergenic
971800615 4:31285538-31285560 CTCACAGTTTCACATGGCTGGGG - Intergenic
971854494 4:32025805-32025827 CTCACAGTTTCACATGGCTGTGG - Intergenic
972023503 4:34345525-34345547 CTCACAGTTCCACATGGCTAGGG - Intergenic
972107059 4:35501891-35501913 CTCACAGTTTCACATGGCTGAGG + Intergenic
972219245 4:36935534-36935556 CTCAGGGTTTCCCTTGGGTAGGG - Intergenic
972402004 4:38713941-38713963 CTCACAGTTTCACATGGCTGAGG + Intergenic
972832582 4:42831910-42831932 CTCACAGTTCCACATGGCTAGGG - Intergenic
972832843 4:42833880-42833902 CTCACAGTTTCACATGGCTGGGG - Intergenic
972908373 4:43780337-43780359 CTCAGATTCTGCCATTTCTATGG - Intergenic
973007876 4:45035282-45035304 CTCACAGTTTCACATGGCTGGGG - Intergenic
973587250 4:52405761-52405783 CTCACAGTTCCACATGGCTAGGG - Intergenic
973715286 4:53670040-53670062 CTCACAGCTTCCCTTGGCTAGGG + Intronic
973722185 4:53735765-53735787 CTCACAGTTCCACATGGCTAGGG - Intronic
973838448 4:54835744-54835766 CTCACAGTCCCACATGGCTGGGG + Intergenic
974066774 4:57086062-57086084 CTCACAGTTTCACATGGCTTGGG + Intronic
974176530 4:58332618-58332640 CTCAGTGGGTCCCATGCCTATGG + Intergenic
974176668 4:58333682-58333704 CTCAGAGGGTCCCATGCCCATGG + Intergenic
974248780 4:59358865-59358887 CTCACAGTTCCACATGGCTAAGG - Intergenic
974251848 4:59394731-59394753 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
974253141 4:59414884-59414906 CTCACAGTCCCACATGGCTGGGG - Intergenic
974425249 4:61734395-61734417 CTCACAGTTCCACATGGCTAAGG + Intronic
974437740 4:61878039-61878061 CTCACAGTTCCACATGGCTAGGG - Intronic
974758701 4:66247468-66247490 CTCACAGTTTCACATGGCTGGGG - Intergenic
974815077 4:66994011-66994033 CTCAGAGTTTCACCTGGCTGAGG + Intergenic
974848134 4:67376208-67376230 CTCACAGTTTTGCATGGCTAAGG - Intergenic
974922639 4:68261150-68261172 CTCACAGTTCCACATGGCTAGGG + Intergenic
975026684 4:69557701-69557723 CTCACAGTTTCACATGGCTTGGG + Intergenic
975064645 4:70045557-70045579 CTCACAGTTTCACATGGCTGGGG + Intergenic
975216387 4:71760878-71760900 CTCACAGTTTCACATGGCTAGGG - Intronic
975279355 4:72541800-72541822 CTCACAGTTCCACATGGCTAGGG - Intronic
975302175 4:72802823-72802845 CTCACAGTTTCACATGGCTGGGG + Intergenic
975367285 4:73544366-73544388 CTCACAGCTTCCCTTGGCTAAGG - Intergenic
975390937 4:73816628-73816650 CTCACAGTTTCACATGGCTGGGG - Intergenic
975489321 4:74971164-74971186 CTCACAGTTCCACATGGCTAGGG + Intronic
975632664 4:76418548-76418570 CTCACAGTTTCACATGGCTGGGG + Intronic
975764614 4:77654652-77654674 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
975917497 4:79342033-79342055 CTCACAGTTTCACATGGCTGGGG + Intergenic
976263077 4:83164405-83164427 CTCAGAGGGTCCCATGCCCATGG + Intergenic
976394838 4:84544866-84544888 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
976677993 4:87724622-87724644 CTCACAGTCCCACATGGCTAGGG - Intergenic
976735485 4:88304646-88304668 CTCACAGTTTCCCATGGCTGGGG + Intergenic
976810001 4:89090258-89090280 CTCACAGTTTCCCTTGGCCAGGG + Intronic
976823402 4:89232760-89232782 CTCACAGTTCCACATGGCTAGGG - Intergenic
976876186 4:89856482-89856504 CTCAGAGGGTCCCATGCCCACGG + Intergenic
976952628 4:90851133-90851155 CTCACAGTTTCACATGCCTAGGG - Intronic
976992334 4:91382482-91382504 CTCAGAGGGTCCCATGACCATGG - Intronic
977013960 4:91669534-91669556 CTCACAGTTCCACATGGCTAGGG + Intergenic
977015843 4:91692697-91692719 CTCACAGTTCCACATGGCTAGGG + Intergenic
977030361 4:91875437-91875459 CTCACAGGTTCACATGGCTAGGG - Intergenic
977046067 4:92070617-92070639 CTCACAGTTTCACATGGCTGGGG + Intergenic
977171309 4:93766273-93766295 CTCACAGTTCCCCATGGCTGGGG + Intronic
977176422 4:93825953-93825975 CTCAGAGTTTCACATTGCTGGGG - Intergenic
977515631 4:98017963-98017985 CTCACAGTCCCACATGGCTAGGG - Intronic
977553346 4:98465193-98465215 CTCACAGCTTCACATGGCTAAGG - Intergenic
977671334 4:99698962-99698984 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
977723546 4:100267991-100268013 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
978139001 4:105296858-105296880 CTCAGGGCTTCCCTTGGCTAGGG - Intergenic
978179601 4:105776565-105776587 CTCAGGGCTTCCCTTGGCTAGGG + Intronic
978243210 4:106540883-106540905 CTCAGAGGGTCCCATGCCCACGG - Intergenic
978342345 4:107731945-107731967 CTCACAGTTTCACATGGCTGGGG + Intergenic
978699104 4:111621709-111621731 CTCATAGTTCCACATGGCTAAGG + Intergenic
978904999 4:113995278-113995300 CTCACAGTTTCACATGGCTGGGG + Intergenic
978988892 4:115052665-115052687 CTCACAGTTCCACATGGCTAGGG - Intronic
979283689 4:118897090-118897112 CTCACAGTTTCACATGGCTGGGG + Intronic
979362542 4:119782308-119782330 CTCAGAGTTCTGCATGGCTAGGG + Intergenic
979421328 4:120509021-120509043 CTCAAAGCTTCCCTTGGCTAGGG - Intergenic
979547617 4:121955297-121955319 CTCACAGTTCCCTATGGCTAGGG + Intergenic
979787373 4:124733073-124733095 CTCACAGTTCCCCATGGCTTGGG - Intergenic
979787610 4:124735545-124735567 CTCACAGTTTCCCATGGCTAGGG - Intergenic
979793390 4:124814647-124814669 CTCACAGTTCCACATGGCTAGGG + Intergenic
979940977 4:126762797-126762819 CTCACAGTTTAGCATGGCTAGGG + Intergenic
980032560 4:127847171-127847193 CTAAATGTCTCCCATGGCTAGGG - Intergenic
980084305 4:128376266-128376288 CTCACAGTTCCACATGGCTAGGG + Intergenic
980096739 4:128499567-128499589 CTCACAGTTCCACATGGCTAGGG + Intergenic
980157699 4:129126748-129126770 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
980430658 4:132689640-132689662 CTCACAGTTTCTCATGGCTGGGG - Intergenic
980512409 4:133812031-133812053 CTCATTGTCTCCCTTGGCTGGGG - Intergenic
980733303 4:136849185-136849207 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
981138972 4:141245319-141245341 CTTACAGTTTCTCATGGCTAGGG - Intergenic
981149869 4:141368485-141368507 CTCAGAGGGTCCCATGCCCATGG - Intergenic
981411191 4:144434845-144434867 CTCAGAGCTTCCCTTGGCTAGGG - Intergenic
981521416 4:145666460-145666482 CTCACAGTTTCACATGGCTGGGG + Intergenic
981695116 4:147551944-147551966 CTCAGAGTTCCACATGGCTGAGG - Intergenic
981797718 4:148616011-148616033 CTCATAGTCTCCCAAGCTTAGGG - Intergenic
981809372 4:148756238-148756260 CTCACAGTTCCGCATGGCTAGGG + Intergenic
981864982 4:149406886-149406908 CTCACAGTCCCACATGGCTGGGG + Intergenic
981915259 4:150026220-150026242 CTCACAGTTCCACATGGCTAGGG - Intergenic
982060342 4:151598260-151598282 CTCACAGTTTCCCTTGGCTAGGG + Intronic
982129336 4:152213374-152213396 CTCATAGTTTCACATGGCTGGGG + Intergenic
982389769 4:154851763-154851785 CTCACAGTTCCACATGGCTAGGG + Intergenic
982430217 4:155314272-155314294 CTCACAGTTTCACATGGCTGGGG - Intergenic
982803765 4:159736751-159736773 CTCACAGTTTCGCATGGCTGGGG - Intergenic
982854478 4:160363424-160363446 CTCACAGTTCCACATGGCTAGGG + Intergenic
982900442 4:160993317-160993339 CTCACAGTTCCACATGGCTAGGG + Intergenic
983047546 4:163004948-163004970 CTCACGGTTTCCCTTGGCTAGGG + Intergenic
983167760 4:164497950-164497972 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
983375160 4:166917774-166917796 CTCACAGTTTCACATGGCTAGGG - Intronic
983636087 4:169899165-169899187 CTCACAGTTCCGCATGGCTAGGG - Intergenic
983699730 4:170577730-170577752 CTCAAAGTTTCACATGGCTGGGG + Intergenic
984026441 4:174548359-174548381 CTCACAGTTCCACATGGCTAGGG - Intergenic
984399248 4:179240691-179240713 CTCATAGTTTCACATGGCTGGGG - Intergenic
984457858 4:179993440-179993462 CTCACAGTTTCACATGGCTGGGG - Intergenic
984811961 4:183803002-183803024 CTCACAGTTTCACATGGCTGGGG + Intergenic
985076942 4:186225087-186225109 CTCACAGTTACCCATGGCTGGGG - Intronic
985813554 5:2109651-2109673 CACATAGTCTCTCCTGGCTACGG + Intergenic
985852776 5:2400888-2400910 CTCACAGTTCCACATGGCTAGGG - Intergenic
985998720 5:3613371-3613393 CACAGAGGCTCCCATGGCAGGGG - Intergenic
986020173 5:3794520-3794542 CTCACAGTTTCACATGGCTGGGG + Intergenic
986021838 5:3811937-3811959 CTCACAGTCCCACATGGCTGGGG + Intergenic
986118199 5:4801537-4801559 CTCACAGTTCCACATGGCTAAGG - Intergenic
986450057 5:7854492-7854514 CTTAGAGTTCCACATGGCTAGGG + Intronic
986469937 5:8063553-8063575 CTCACAGTACCACATGGCTAGGG + Intergenic
986507641 5:8469746-8469768 CTCACAGTTTCGCAGGGCTAGGG + Intergenic
986532984 5:8758631-8758653 CTCACAGTTTCTCATGGCTGGGG - Intergenic
986545416 5:8891799-8891821 CTCACAGTTCCACATGGCTAGGG + Intergenic
986610030 5:9557915-9557937 ATCAGAGTCTCCCAGGGGTGGGG + Intergenic
986668309 5:10121876-10121898 CTCACAGTTTCACATGGCTGGGG - Intergenic
986695152 5:10348505-10348527 CGCAGACTCTCACATGCCTAAGG + Intergenic
986750239 5:10780285-10780307 CTCAGAGGGTCCCATGCCCAAGG + Intergenic
986854099 5:11849103-11849125 CTCACAGTTCCACATGGCTAGGG + Intronic
986948729 5:13056156-13056178 CTCACAGTTTCACATGGCTGGGG - Intergenic
987011294 5:13768380-13768402 CTCAGAGTTCCGCATGGCTGGGG - Intronic
987245808 5:16047651-16047673 CTCATAGTTTCACATGGCTGTGG - Intergenic
987465332 5:18265314-18265336 CTCACAGTTCCACATGGCTATGG - Intergenic
987532600 5:19141984-19142006 CTCACAGTTTCACATGGCTGCGG + Intergenic
987662588 5:20895550-20895572 CTCACAGTTTCACATGGCTGGGG - Intergenic
988283652 5:29183947-29183969 CTCACAGTTTCACATGGCTGGGG + Intergenic
988289741 5:29270263-29270285 CTCACAGTTTCCCTTGGCTGGGG - Intergenic
988310175 5:29547584-29547606 CTCACAGTTTCACATGGCTGGGG + Intergenic
988322217 5:29713268-29713290 CTCACAGTCCCTCATGGCTGGGG + Intergenic
988344341 5:30018524-30018546 CTCAGAGTTCCACATGGCTTGGG - Intergenic
988760995 5:34309767-34309789 CTCACAGTTTCACATGGCTGGGG + Intergenic
988867764 5:35354271-35354293 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
988945210 5:36189995-36190017 CTCAGAGGGTCCCATGCCCATGG - Intergenic
989030465 5:37113403-37113425 CTCACAGTTTCACATGGCTGTGG - Intronic
989204052 5:38794176-38794198 CTCACAGTTCCACATGGCTAGGG + Intergenic
989269014 5:39510283-39510305 CTCAGAGTTCCACATGGCTGGGG + Intergenic
989296936 5:39839381-39839403 CTCACAGTTCCACATGGCTAGGG - Intergenic
989724505 5:44572248-44572270 CTCACAGTTTCACATGGCTGGGG - Intergenic
989731534 5:44655404-44655426 CTCACAGTTCCCCATGGCTGGGG - Intergenic
989793211 5:45432858-45432880 CTCGCAGTTTCACATGGCTAGGG + Intronic
990060922 5:51647286-51647308 CTGACAGTTTCACATGGCTAGGG - Intergenic
990183835 5:53191562-53191584 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
990278712 5:54227042-54227064 CTCACAGTTCCACATGGCTAGGG - Intronic
990294722 5:54389419-54389441 CTCAGAGTTCCACATGGCTGGGG + Intergenic
990374539 5:55156044-55156066 CTCACAGTTCCACATGGCTAGGG + Intronic
990700925 5:58474445-58474467 CTCACAGTTCCACATGGCTAGGG + Intergenic
991222809 5:64235891-64235913 CTCACAGTTCCACATGGCTAGGG - Intronic
991271430 5:64786924-64786946 CTCACAATTTCACATGGCTAGGG + Intronic
991273836 5:64819651-64819673 CTCACAGTTTCACATGGCTGGGG - Intronic
991397831 5:66223107-66223129 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
991559212 5:67931537-67931559 CTCATAGTTCCACATGGCTATGG + Intergenic
991988227 5:72311614-72311636 CTCAGAGCATCACATGGCGAGGG - Intronic
991992238 5:72351556-72351578 CTCACAGTATCACATGGCTGGGG + Intronic
992157107 5:73966471-73966493 CTCAGAGTGTACCCTGGGTAGGG + Intergenic
992292495 5:75293476-75293498 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
993001069 5:82380866-82380888 CTTACAGTTTCACATGGCTAGGG + Intronic
993073211 5:83191813-83191835 CTTAGAGTTTCACATGGCTGGGG - Intronic
993141932 5:84045004-84045026 CTCACAGTTCCACATGGCTAAGG + Intronic
993196784 5:84758543-84758565 CTCACAGTTCCACATGGCTAGGG - Intergenic
993226778 5:85176616-85176638 CTCACAGTTCCCCATGGCTGGGG + Intergenic
993242154 5:85403951-85403973 TTCAGAGTTCCACATGGCTAGGG - Intergenic
993244274 5:85431820-85431842 CTCAGAGGGTCCCATGCCCAAGG + Intergenic
993285653 5:85992145-85992167 CTCAGAGTTCCACATGGCTGGGG - Intergenic
993331667 5:86607824-86607846 CTCACAGTTACACATGGCTAGGG + Intergenic
993381928 5:87218095-87218117 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
993413322 5:87597561-87597583 CTCACAGTTCCACATGGCTAGGG + Intergenic
993517685 5:88857774-88857796 CTCACAGTTTCACATGGCTGGGG - Intronic
993567018 5:89488977-89488999 CTCACAGTTTCACATGGCTGGGG + Intergenic
993742244 5:91555723-91555745 CTCAGAGGGTCCCATGCCCATGG + Intergenic
993757694 5:91751429-91751451 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
993891628 5:93482363-93482385 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
994152415 5:96462957-96462979 CTCACAGTTTCACATGGCTGGGG - Intergenic
994179096 5:96744302-96744324 CTCACAGTTCCTCATGGCTAGGG + Intronic
994254002 5:97571105-97571127 CTCACAGTTCCGCATGGCTAGGG + Intergenic
994265678 5:97713585-97713607 CTCACAGTTTCACATGGCTGGGG + Intergenic
994387218 5:99146507-99146529 CTCAGAGGGTCCCATGCCCATGG + Intergenic
994426943 5:99602090-99602112 CTCAGAATCACCCATGGATATGG + Intergenic
994450489 5:99935179-99935201 CTCATAGTTCCACATGGCTAGGG - Intergenic
994528530 5:100935863-100935885 CTCAGAGGGTCCCATGGCCACGG - Intergenic
994539007 5:101070963-101070985 CTCACAGTTCCGCATGGCTAGGG + Intergenic
994641890 5:102421031-102421053 CTCACAGCTTCCCTTGGCTAGGG - Intronic
994653847 5:102564090-102564112 CTCACAGTTTCACATGGCTGGGG - Intergenic
994764693 5:103901142-103901164 CTCACAGTTCCACATGGCTAGGG - Intergenic
994930592 5:106178226-106178248 CTCACAGTTCCACATGGCTAGGG + Intergenic
995120431 5:108530830-108530852 CTCATAGTTCCCCATGGCTGGGG + Intergenic
995212303 5:109554005-109554027 CTCACAGTTCCACATGGCTAGGG + Intergenic
995248843 5:109966169-109966191 CTCAGAGTCTCTCTTAGCTCTGG - Intergenic
995255812 5:110045172-110045194 CTCATAGTTCCACATGGCTAGGG - Intergenic
995474971 5:112538864-112538886 CTCAAAGCTTCCCTTGGCTAGGG - Intergenic
995484982 5:112631073-112631095 CCAAGAGTGTCCCATGGCCAAGG - Intergenic
995684588 5:114758532-114758554 CTCACAGTTCCACATGGCTAGGG + Intergenic
995690793 5:114824311-114824333 CTCACAGTCCCACATGGCTAGGG + Intergenic
995702556 5:114952840-114952862 CTCACAGTTCCACATGGCTAGGG + Intergenic
995723688 5:115164433-115164455 CTCACAGTTCCACATGGCTAGGG + Intronic
995749837 5:115442243-115442265 CTCAGAGTGTCCCACGCCCATGG + Intergenic
996046609 5:118881620-118881642 CTCAGAGTTCCACATGGCTGGGG + Intronic
996973154 5:129397410-129397432 CTCACAGTTCCACATGGCTAGGG + Intergenic
997022158 5:130014398-130014420 CTCACAGTTTCACATGGCTAGGG + Intronic
997386050 5:133473739-133473761 CTCACAGTTTCCCATGGCTAGGG + Intronic
997389668 5:133503885-133503907 CTCATAGTTTCCCAGGGCTGGGG + Intronic
997656214 5:135556648-135556670 CTCACAGTTCCGCATGGCTAGGG + Intergenic
997767895 5:136523785-136523807 CTCACAGTTCCTCATGGCTAGGG + Intergenic
997773263 5:136574077-136574099 CTAAGGGTCTACCATGGATAGGG - Intergenic
997809596 5:136954271-136954293 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
997830159 5:137142718-137142740 TTCAGAGTCTTCCAAGGCTGGGG + Intronic
998431296 5:142072587-142072609 CTCAGAGTTCCACATGGCTGGGG + Intergenic
998793395 5:145791098-145791120 CTCACAGTTCCACATGGCTAGGG + Intronic
999047134 5:148481739-148481761 GTCAGAATCTCACATGGCTCTGG + Exonic
999201891 5:149822505-149822527 CTCAGAGTTTCCGATGGGCAGGG - Intronic
1000032641 5:157417854-157417876 CTCAGAGGGTCCCATGCCCAAGG + Intronic
1000111727 5:158114429-158114451 CTCACAGTTCCCCATGGCTGGGG - Intergenic
1000139261 5:158385632-158385654 CTCACAGTTACCCATGGCTGGGG + Intergenic
1000261819 5:159595680-159595702 CTTACAGTCCCACATGGCTAGGG + Intergenic
1000514892 5:162227472-162227494 CTCACAGTCCCACATGGCTAGGG + Intergenic
1000751503 5:165100842-165100864 CTCACAGTTTCACATGGCTAGGG + Intergenic
1001215409 5:169851680-169851702 CTCACAGTTTCTCATGGCTGGGG + Intronic
1001860611 5:175051548-175051570 CTCACAGTTTCACATGGCTGGGG - Intergenic
1002216589 5:177639312-177639334 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1002376477 5:178792583-178792605 CTCAGAGTTTCACATGGCTGGGG - Intergenic
1002869989 6:1157881-1157903 CTCACAGTTTTGCATGGCTAGGG - Intergenic
1002944731 6:1750496-1750518 CTCAAGGTTTCCCTTGGCTAGGG - Intronic
1003027536 6:2569531-2569553 CTCACAGTTCCCCATGGCTGGGG + Intergenic
1003144668 6:3499554-3499576 CTCCCAGGCTCCTATGGCTAAGG - Intergenic
1003776439 6:9370812-9370834 CTCACAGTCCCACATGGCTGGGG + Intergenic
1004027926 6:11837102-11837124 CTCATGGTTTCCCCTGGCTAGGG - Intergenic
1004450885 6:15745111-15745133 CTCACAGTTCCCCATGGCTAGGG - Intergenic
1004805819 6:19202580-19202602 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1004839103 6:19562154-19562176 CTCACAGTTCCACATGGCTAGGG - Intergenic
1005162053 6:22875597-22875619 CTCACAGTTTCACATGGCTGGGG + Intergenic
1005180316 6:23096722-23096744 CTCATAGTATCACATGCCTAGGG - Intergenic
1005274113 6:24198418-24198440 CTCAGGGCTTCCCTTGGCTAGGG - Intronic
1005362741 6:25047075-25047097 CTCACAGTTCCACATGGCTAGGG + Intergenic
1005916810 6:30359550-30359572 CTTAGAGGCTCCTGTGGCTAAGG + Intergenic
1006816546 6:36854504-36854526 CTCACAGTTCCACATGGCTAGGG - Intergenic
1007246583 6:40467700-40467722 CTCAGAACCTCCCATGGCCGAGG - Intronic
1007845089 6:44747803-44747825 CTCAGAGGGTCCCATGCCCACGG + Intergenic
1008259002 6:49342102-49342124 CTCACAGTTCCACATGGCTAAGG - Intergenic
1008281245 6:49598908-49598930 CTCAGAGGGTCCCATGCCCATGG + Intergenic
1008388493 6:50921608-50921630 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1008650258 6:53553909-53553931 CTTACAGTTTCACATGGCTAGGG - Intronic
1008739204 6:54584657-54584679 CTCACAGTTCCACATGGCTAGGG - Intergenic
1008825073 6:55684191-55684213 CTCACAGTTTCACATGGCTGGGG - Intergenic
1008828313 6:55726748-55726770 CTCAGAGTGTCACATGGCTGGGG + Intergenic
1009264048 6:61531705-61531727 CGCACAGTTTCCCTTGGCTAGGG - Intergenic
1009458688 6:63887570-63887592 CTCAGGGCTTCCCTTGGCTAGGG - Intronic
1009723593 6:67507313-67507335 CTCACAGTTTCACATGGCTGGGG + Intergenic
1009738191 6:67706668-67706690 CTCACAGTTTCACATGGCTGGGG + Intergenic
1009763410 6:68037979-68038001 CTCACAGTTCCCCATGGCTGGGG + Intergenic
1009827998 6:68892324-68892346 CTCAGAGGCTGCTGTGGCTAGGG - Intronic
1010310458 6:74378709-74378731 CTCAGAGGCTCCTATGCCCATGG - Intergenic
1010340976 6:74752291-74752313 CTCACAGTTCCACATGGCTAAGG + Intergenic
1010367454 6:75067742-75067764 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1010531102 6:76967793-76967815 CTCACAGTTCCACATGGCTAAGG - Intergenic
1010821842 6:80423272-80423294 CTCACAGTTTCACATGGCTGAGG - Intergenic
1010869272 6:81017838-81017860 CTCAGAGGGTCCCATGCCCATGG - Intergenic
1010876918 6:81117821-81117843 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1011055505 6:83199572-83199594 CTCACAGTTCCACATGGCTAGGG + Intergenic
1011065434 6:83321067-83321089 CTCACAGCTTCCCTTGGCTAGGG - Intronic
1011235647 6:85213384-85213406 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
1011244433 6:85307389-85307411 CTCAGAGGGTCCTATGCCTACGG + Intergenic
1011345987 6:86370045-86370067 CTCACAGTTTCACATGGCTGAGG + Intergenic
1011410698 6:87063026-87063048 CTCACAGTTTCGCATGGCTGGGG + Intergenic
1011776853 6:90739972-90739994 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
1012074796 6:94670275-94670297 CTCACAGTTTCACATGGCTGGGG - Intergenic
1012097055 6:94976474-94976496 CTCACAGTTACACATGGCTAAGG + Intergenic
1012127477 6:95449232-95449254 CTCACAGTTTACCATGGCTGGGG + Intergenic
1012254313 6:97015137-97015159 CTCACAGTTGCACATGGCTAGGG - Intronic
1012495975 6:99833857-99833879 CTCTAATTCTCCCATGTCTATGG + Intergenic
1012594407 6:101023299-101023321 CTCACAGTTCCACATGGCTAGGG - Intergenic
1012597190 6:101054376-101054398 CTCATGGCCTCCCTTGGCTAGGG + Intergenic
1012627026 6:101417052-101417074 CTCACAGTTCCACATGGCTAGGG + Intronic
1012674697 6:102100667-102100689 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1012706710 6:102539943-102539965 CTCACAGTTCCACATGGCTAGGG - Intergenic
1012726346 6:102815821-102815843 CTCACAGTTTCACATGGCTGGGG + Intergenic
1013539708 6:111095828-111095850 CTCACAGTTCCACATGGCTAGGG - Intronic
1013661077 6:112297718-112297740 CTCACAGTTCCGCATGGCTAGGG + Intergenic
1013920221 6:115394824-115394846 CTCACGGTTTCCCTTGGCTAGGG + Intergenic
1014177095 6:118342770-118342792 CTCACAGCTTCCCTTGGCTAAGG + Intergenic
1014199888 6:118597140-118597162 CTCAGAGTTCCACATGGCTGGGG - Intronic
1014240258 6:119009515-119009537 CTCACAGTTCCACATGGCTAGGG - Intronic
1014342442 6:120227267-120227289 CTCACAGTTCCCCATGGCTGTGG + Intergenic
1014429686 6:121353593-121353615 CTCACAGTTCCACATGGCTAGGG + Intergenic
1014444636 6:121513077-121513099 CTCACAGTTTCGCATGGCTGGGG - Intergenic
1014528031 6:122523887-122523909 CTCACAGTTTCACATGGCTGGGG - Intronic
1014562167 6:122904557-122904579 CTCACAGTTTCACATGGCTAAGG - Intergenic
1014922363 6:127228400-127228422 CTCATGGTTTCCCTTGGCTAGGG - Intergenic
1014968227 6:127782525-127782547 CTCACAGCTTCCCTTGGCTAGGG + Intronic
1015049157 6:128818073-128818095 CTTACAGTTTCACATGGCTAGGG + Intergenic
1015050080 6:128829815-128829837 CTCAGAGGGTCCCATGCCCACGG + Intergenic
1015081256 6:129228105-129228127 CTCGGAGGGTCCCATGCCTACGG - Intronic
1015298243 6:131623779-131623801 CTCACAGTTTGGCATGGCTAGGG - Intronic
1015471804 6:133614524-133614546 CTCAGGGCTTCCCTTGGCTAGGG - Intergenic
1015649101 6:135434653-135434675 CTCAGATTCTACCATGGCCTGGG - Intronic
1015702812 6:136054768-136054790 CTCACATTTTCACATGGCTAGGG + Intronic
1016348291 6:143140035-143140057 CTCACAGTTTCACATGGCTGTGG + Intronic
1016434768 6:144024568-144024590 CTCACAGTTCCACATGGCTAAGG - Intronic
1016501469 6:144725290-144725312 CTCATAGTTCCCCATGGCTGGGG - Intronic
1016638778 6:146324651-146324673 CTCACAGCTTCCCTTGGCTAGGG + Intronic
1016691597 6:146943806-146943828 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1016804411 6:148198264-148198286 CTCACAGTTTCACATGGCTGGGG - Intergenic
1016919482 6:149277112-149277134 CTCACAGTCCCACATGGCTGGGG - Intronic
1017197485 6:151717084-151717106 CTCAGGGCTTCCCTTGGCTAGGG + Intronic
1017225495 6:152016199-152016221 CTCAGAGTTCCACATGGCTGAGG - Intronic
1017299181 6:152835828-152835850 CTCACAGTTCCACATGGCTAAGG + Intergenic
1017322555 6:153110850-153110872 CTCATGGTTTCCCTTGGCTAGGG - Intronic
1017571346 6:155748495-155748517 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1017606120 6:156135154-156135176 CTCACAGTCCCACATGGCTGGGG + Intergenic
1017907711 6:158768314-158768336 CTCACAGTCCCACATGGCTGGGG - Intronic
1018245011 6:161814392-161814414 CTCACAGTTTCACATGGCTAAGG + Intronic
1018280930 6:162184615-162184637 CTCACAGTTCCGCATGGCTAGGG - Intronic
1018476528 6:164147829-164147851 CTCACAGTTTCACATGGCTGGGG - Intergenic
1018506967 6:164482430-164482452 CTCACAGTTCCACATGGCTAGGG + Intergenic
1018523419 6:164679178-164679200 CTCACAGTTCCCCATGGCTGGGG + Intergenic
1018585344 6:165350899-165350921 CTCACAGTTTAGCATGGCTAGGG - Intronic
1018666550 6:166143616-166143638 CTCACAGTTTCACATGGCTGGGG - Intergenic
1018783092 6:167086711-167086733 CTCAGAGAATCCCATGCCCACGG - Intergenic
1019394181 7:808008-808030 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1019941454 7:4295235-4295257 CTTAGAGTTCCACATGGCTAGGG + Intergenic
1020229437 7:6306349-6306371 CTCACAGTTTCACATGGCTGGGG - Intergenic
1020343314 7:7135966-7135988 CTCACAGTTTCACATGGCTGGGG + Intergenic
1020392446 7:7672715-7672737 CTCACAGTTTCACATGGCTGGGG - Intronic
1020639834 7:10741825-10741847 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1020683788 7:11268815-11268837 CTCACAGTTTCACATGGCTGGGG - Intergenic
1020753480 7:12171084-12171106 CTCATAGCATCCCTTGGCTAGGG + Intergenic
1020935425 7:14458612-14458634 CTCAGGGCTTCCCTTGGCTATGG - Intronic
1020942961 7:14563185-14563207 CTCACAGTTTCACATGGCTGGGG - Intronic
1020950783 7:14674466-14674488 CTTAGAATCTGCCATGGCCATGG + Intronic
1021014596 7:15517578-15517600 CTCACAGCTTCCCTTGGCTAGGG - Intronic
1021110988 7:16694414-16694436 CTCAGAGTATCACATGGCGAGGG + Intronic
1021787038 7:24162859-24162881 CTCACAGTTCCGCATGGCTAAGG - Intergenic
1021826049 7:24552391-24552413 CTCACAGTTTCACATGGCTGGGG - Intergenic
1021890485 7:25181262-25181284 CTCACAATCTCACATGGCTGCGG - Intergenic
1022639200 7:32165465-32165487 CTCACAGTTCCACATGGCTAGGG + Intronic
1022804995 7:33812609-33812631 CTCACAGTTCCACATGGCTAGGG - Intergenic
1022987014 7:35665393-35665415 CTCAGAGGGTCCCATGCCCAAGG - Intronic
1023189236 7:37561624-37561646 CCCACAGTCTCCCCTGGCTGTGG + Intergenic
1023406780 7:39842160-39842182 CTCACAGTTTAGCATGGCTAGGG - Intergenic
1024220887 7:47285548-47285570 CTCACAGTTTCACATGGCTGGGG - Intronic
1024347412 7:48327177-48327199 CTCACAGTTTCACATGGCTGGGG + Intronic
1024406567 7:48988560-48988582 CTCACAGTTTCACATGGCTGGGG - Intergenic
1024492546 7:50002130-50002152 CTCACAGTTCCACATGGCTAGGG + Intronic
1024664979 7:51537006-51537028 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1024684782 7:51733630-51733652 CTCACAGTTTCACATGGCTGGGG + Intergenic
1025110508 7:56212305-56212327 CTCACAGTTTCACATGGCTGGGG - Intergenic
1025582930 7:62742550-62742572 CTCAGAGGATCCCATGCCGAAGG - Intergenic
1025797700 7:64755393-64755415 CTCACAGTTTTACATGGCTAAGG + Intergenic
1026194091 7:68157432-68157454 CTCAAGGTCTCCAAAGGCTAAGG - Intergenic
1026291118 7:69007122-69007144 CTCAGAGTTTCATATGGCTGGGG + Intergenic
1026310603 7:69180537-69180559 CTCATAGTCCCGCATGGCTAGGG + Intergenic
1026606843 7:71823796-71823818 CTCACAGTTCCACATGGCTAGGG + Intronic
1027442667 7:78236838-78236860 CTCAAAGTTTCACATGGCTGGGG + Intronic
1027560086 7:79718669-79718691 CTCACAGTTTCACATGGCTAGGG + Intergenic
1027584934 7:80045757-80045779 CTCACAGTTCCCCATGGCTCGGG + Intergenic
1027648777 7:80838648-80838670 CTCACAGTTTCACATGGCTGTGG + Intronic
1027690517 7:81338904-81338926 CTCACAGTTCCTCATGGCTAGGG - Intergenic
1027785553 7:82574968-82574990 CTCACAGTTTCCCATGGCTGGGG + Intergenic
1028047626 7:86142742-86142764 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1028078746 7:86548058-86548080 CTCAGCGGGTCCCATGCCTAAGG - Intergenic
1028142683 7:87289967-87289989 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1028286612 7:89011045-89011067 CTCAGAGTTCTCCATGGCTGGGG + Intronic
1028994456 7:97085065-97085087 CTCACAGTCACACATGGCTGGGG + Intergenic
1029063656 7:97825756-97825778 CTCACAGTTTCACATGGCTGGGG - Intergenic
1029845318 7:103406408-103406430 CTCACAGCTTCCCTTGGCTAAGG + Intronic
1029906687 7:104100091-104100113 CTCACGGTTCCCCATGGCTAGGG - Intergenic
1029939110 7:104461071-104461093 CTCACAGTTTCACATGGCTGGGG + Intronic
1030141100 7:106304714-106304736 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1030271007 7:107668147-107668169 CTCAAAGGCTCTCATGGATAAGG + Intronic
1030411676 7:109189016-109189038 CTCACAGTTTCACATGGCTGGGG + Intergenic
1030482241 7:110119620-110119642 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1030660491 7:112213261-112213283 CTTAGAGTTTCACATGGCTGGGG - Intronic
1030754534 7:113272146-113272168 CTCACAGTTCCACATGGCTAGGG + Intergenic
1030807478 7:113935709-113935731 CTTACAGTTTCACATGGCTAAGG + Intronic
1030965582 7:115989588-115989610 CTCAGAGGGTCCCATGCCCACGG + Intronic
1031175310 7:118341232-118341254 CTCACAGTTTCACATGGCTAGGG - Intergenic
1031406377 7:121392285-121392307 CTCACAGTCCCACATGGCTGGGG + Intronic
1031532283 7:122889161-122889183 CTCAGAGTTCCGCATGGCTGGGG - Intergenic
1031645729 7:124222596-124222618 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1031710935 7:125046214-125046236 CTCATAGCTTCCCTTGGCTAGGG - Intergenic
1031715805 7:125107950-125107972 CTCACAGTTCCACATGGCTAGGG + Intergenic
1031829891 7:126613743-126613765 CTCAGAGGGTCCCATGCCCACGG + Intronic
1031904076 7:127441580-127441602 CTCACAGTTCCACATGGCTAGGG - Intergenic
1032312649 7:130802752-130802774 CTCAGGGCGTCCCTTGGCTAGGG + Intergenic
1032366635 7:131306167-131306189 CTCACAGTTTCACATGGCTGGGG - Intronic
1032414964 7:131728874-131728896 CTCACAGTTTCACATGGCTGTGG + Intergenic
1032440486 7:131939062-131939084 CTCACAGTTCCGCATGGCTAGGG - Intergenic
1032696396 7:134340201-134340223 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1032703964 7:134406112-134406134 CTCATAGTGCCCCATGGCTGGGG - Intergenic
1032884304 7:136121491-136121513 CTCACAGTTCCACATGGCTAGGG - Intergenic
1032889926 7:136183223-136183245 CTCACAGTTCCACATGGCTAGGG + Intergenic
1033487595 7:141806059-141806081 CTCACAGTTCCACATGGCTAGGG - Intergenic
1033810287 7:145003874-145003896 CTCACAGTTCCACATGGCTAGGG - Intergenic
1034012493 7:147544914-147544936 CTCACAGTTCCACATGGCTAGGG - Intronic
1034045997 7:147928172-147928194 TTCACAGTTTCACATGGCTAGGG - Intronic
1034517242 7:151590518-151590540 CTCCGAGCCTCCCATGGCAGTGG + Intronic
1034565827 7:151914955-151914977 CTCAGGGTCTCACAAGGCTGAGG - Intergenic
1034715177 7:153235223-153235245 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
1034718216 7:153263433-153263455 CTCACAGTTCCACATGGCTAGGG + Intergenic
1034760992 7:153671668-153671690 CTCACAGTTCCACATGGCTAGGG - Intergenic
1035086339 7:156262073-156262095 CTCCGAGTTTCCCATGGGAAGGG + Intergenic
1035883853 8:3270836-3270858 CTCACAGTTTCACATGGCTGGGG + Intronic
1036125811 8:6061207-6061229 CTCACAGTTCCCCATGGCTGGGG + Intergenic
1036414542 8:8535011-8535033 CTCACAGTTTCACATGGCTGGGG + Intergenic
1036921659 8:12861616-12861638 CTCACAGTTCCACATGGCTAGGG + Intergenic
1036993801 8:13631121-13631143 CTCAAAGTTCCACATGGCTAGGG + Intergenic
1037331297 8:17746433-17746455 CTCAGAGTTCCACGTGGCTAGGG + Intronic
1037338297 8:17813437-17813459 CTCACAGTTTCACATGGCTGGGG + Intergenic
1037640985 8:20743045-20743067 CTCAGAGGGTCCCATGCCCATGG + Intergenic
1037660115 8:20919186-20919208 CTCACAGTTTCACATGGCTGGGG + Intergenic
1037721991 8:21452280-21452302 CTCACAGTTTCACATGGCTGGGG + Intergenic
1038094520 8:24293046-24293068 CTCACAGTTTCACATGGCTGGGG + Intergenic
1038315179 8:26478279-26478301 CTCACTGTCCCACATGGCTATGG - Intronic
1038850612 8:31271734-31271756 CTCACAGTTTCACATGGCTGGGG - Intergenic
1038870605 8:31489587-31489609 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1039015661 8:33146350-33146372 CTCACAGTTTCCCATGGCTGGGG + Intergenic
1039154555 8:34540585-34540607 CTCAGAGGGTCCCATGCCCATGG + Intergenic
1039282849 8:36005829-36005851 CTCACAGTTCCACATGGCTAGGG - Intergenic
1039282908 8:36006326-36006348 CTCCCAGTTTCCCTTGGCTAGGG - Intergenic
1039668651 8:39568255-39568277 CTCACAGTTTCACATGGCTTGGG + Intergenic
1039684252 8:39780065-39780087 CTCACAGTTTCACATGGCTGGGG + Intronic
1040520164 8:48169612-48169634 CTCATGGTTTCCCTTGGCTAGGG + Intergenic
1040802064 8:51352654-51352676 CTCACAGTTTCACATGGCTGGGG - Intronic
1041318724 8:56591836-56591858 CTCACAGTTTCACATGGCTGGGG - Intergenic
1041403562 8:57471113-57471135 CTCACAGTTTCACATGGCTGGGG + Intergenic
1041419144 8:57647210-57647232 CTCATGGCCTCCCTTGGCTAGGG + Intergenic
1041459810 8:58098755-58098777 CTCACAGCTTCCCTTGGCTAGGG + Intronic
1041584028 8:59495323-59495345 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1041630641 8:60083162-60083184 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1041666257 8:60447978-60448000 CTCACAGTTTCCCTTGGCTAGGG - Intergenic
1041836573 8:62223338-62223360 CTCAAGGTTTCCCTTGGCTAGGG - Intergenic
1042073783 8:64966652-64966674 CTTACAGTTTCACATGGCTAGGG + Intergenic
1042327309 8:67541725-67541747 CTCAGGGCTTCCCTTGGCTAGGG + Intronic
1042462087 8:69081203-69081225 CTTACAGTCCCACATGGCTAGGG - Intergenic
1042627229 8:70771140-70771162 CTCAAAGCTTCCCTTGGCTAGGG + Intronic
1042946124 8:74156418-74156440 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1042969371 8:74391408-74391430 CTCACAGCTTCCCTTGGCTAGGG + Intronic
1043032652 8:75156628-75156650 CTCACAGTTCCACATGGCTAGGG - Intergenic
1043170627 8:76961520-76961542 CTCACAGTTCCACATGGCTAGGG - Intergenic
1043762297 8:84082632-84082654 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1043776767 8:84279052-84279074 CTCACAGTCCCACATGGCTGGGG + Intronic
1043996368 8:86822563-86822585 CTCACAGTTGCACATGGCTAGGG - Intergenic
1044046997 8:87448509-87448531 CTCACAGTTCCACATGGCTAGGG + Intronic
1044103816 8:88175968-88175990 CTCACAGTTCCACATGGCTAGGG - Intronic
1044205925 8:89491767-89491789 CTCACAGTTTCACATGGCTGGGG - Intergenic
1044947806 8:97407580-97407602 CTCAGAGAGTCCCATTCCTAAGG - Intergenic
1045140155 8:99271637-99271659 CTCACAGTTCCACATGGCTAGGG + Intronic
1045437798 8:102181949-102181971 CTCATAGTTCCACATGGCTAGGG - Intergenic
1045717725 8:105067800-105067822 CTCACAGTCTTGCATGGCCAGGG - Intronic
1045839284 8:106560923-106560945 CTCACAGCTTCCCTTGGCTAGGG - Intronic
1046295796 8:112218039-112218061 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1046330860 8:112713164-112713186 CTCACTGCCTCCCTTGGCTAAGG - Intronic
1046697244 8:117356080-117356102 CTCACAGTTCCACATGGCTATGG + Intergenic
1047084995 8:121506310-121506332 CTCACAGTTTCACATGGCTGGGG - Intergenic
1047155021 8:122307293-122307315 CTCACAGTTCCACATGGCTAGGG + Intergenic
1047178783 8:122567572-122567594 CTCACAGTTTCACATGGCTGGGG + Intergenic
1047608963 8:126502112-126502134 CTCACAGTTTCCCATGGCTGGGG - Intergenic
1047617672 8:126576431-126576453 CTTACAGTTCCCCATGGCTAGGG + Intergenic
1047980018 8:130171356-130171378 CTCACAGTTCCACATGGCTAGGG + Intronic
1048043441 8:130752143-130752165 CTCACAGTTTCACATGGCTGGGG + Intergenic
1048304833 8:133276716-133276738 CTCACAGTTTCACATGGCTGGGG - Intronic
1048376628 8:133828300-133828322 CTCACAGTTTCACATGGCTAGGG + Intergenic
1048416645 8:134234601-134234623 CTCACAGTTCCACATGGCTAGGG + Intergenic
1048508456 8:135041718-135041740 CTCACAGTTCCACATGGCTAGGG + Intergenic
1048659132 8:136575963-136575985 CTCACAGTTTCACATGGCTAGGG + Intergenic
1048668809 8:136694254-136694276 CTCATAGTTCCACATGGCTAGGG - Intergenic
1048726032 8:137386480-137386502 CTCACAGTTTCACATGGCTGAGG + Intergenic
1048760522 8:137789540-137789562 CTCAGAGTTTCACGTGGCTGGGG + Intergenic
1048801503 8:138198287-138198309 CTCACAGTTCCACATGGCTAGGG - Intronic
1048821229 8:138382433-138382455 CTCATAGTCTCACAGGGATATGG + Intronic
1048824262 8:138408608-138408630 CTCACAGTCTTGCATGGCTGGGG + Intronic
1050031699 9:1393317-1393339 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1050237203 9:3594582-3594604 CTCACAGTTCCACATGGCTAGGG + Intergenic
1050239958 9:3624581-3624603 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1050497943 9:6264091-6264113 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1050715076 9:8515028-8515050 CTCACAATTTCACATGGCTAGGG - Intronic
1050819925 9:9865457-9865479 CACAGAGTGTCACATGGCAAAGG - Intronic
1050886966 9:10778635-10778657 CTCAGAGGGTCCCATGCCCAGGG + Intergenic
1051371049 9:16359404-16359426 CTTATAGTTTCACATGGCTAGGG - Intergenic
1051382092 9:16469486-16469508 CTTACAGTTCCCCATGGCTAAGG - Intronic
1051424513 9:16919985-16920007 CTCACAGTTTCACATGGCTGGGG + Intergenic
1051552057 9:18340808-18340830 CTCACAGTTTCACATGGCTGGGG - Intergenic
1051813884 9:21081675-21081697 CCCAGAGGCTCTCATGGCTGTGG + Intergenic
1051821972 9:21179956-21179978 CCCAGAGGCTCCAATAGCTAAGG - Intergenic
1052105441 9:24509418-24509440 CTCACAGTTTCACATGGCTCGGG - Intergenic
1052146456 9:25056042-25056064 TTCAGAGTTTCACATGGCTGGGG + Intergenic
1052210295 9:25895118-25895140 CTCACAGTTTCACATGGCTGGGG + Intergenic
1052499416 9:29270557-29270579 CTCAGAGGGTCCCATGCCCACGG + Intergenic
1052565209 9:30140981-30141003 CTCAGAGCTTCACATGGCTGAGG + Intergenic
1052726194 9:32230687-32230709 CTCAGAGTGTCCTATGCCCATGG - Intergenic
1053125751 9:35579467-35579489 CTCACAGTTCCACATGGCTAGGG - Intergenic
1053183185 9:35991960-35991982 CTCTGTGGCTCCCATGGCAAGGG + Intergenic
1053184462 9:36003532-36003554 CTCTGTGGCTCCCATGGCAAAGG + Intergenic
1053185585 9:36013487-36013509 CTCTGTGGCTCCCATGGCAAAGG - Intergenic
1053571774 9:39317575-39317597 CTCATAGTTTCACATGGCTGGGG - Intergenic
1053717996 9:40916135-40916157 CTCGGAGGGTCCTATGGCTATGG + Intergenic
1054093332 9:60876283-60876305 CTCATAGTTTCACATGGCTGGGG - Intergenic
1054114814 9:61152204-61152226 CTCATAGTTTCACATGGCTGGGG - Intergenic
1054125371 9:61301436-61301458 CTCATAGTTTCACATGGCTGGGG + Intergenic
1054592942 9:67030329-67030351 CTCATAGTTTCACATGGCTGGGG + Intergenic
1054828066 9:69592759-69592781 CTCAGAGTTCCGCATGGCTGGGG - Intronic
1055391638 9:75828177-75828199 CTCACAGTTCCACATGGCTAGGG + Intergenic
1055571702 9:77623681-77623703 CTCAGGGCTTCCCTTGGCTAGGG - Intronic
1055628690 9:78200867-78200889 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1055659705 9:78490657-78490679 CTCACAGTTCCACATGGCTAGGG - Intergenic
1055665077 9:78545221-78545243 CTCACAGTTCCACATGGCTAGGG + Intergenic
1055710776 9:79059720-79059742 CTCACAGTTTCACATGGCTGAGG + Intergenic
1055725018 9:79218227-79218249 CTCAGGGTGTCACATGGCGAGGG + Intergenic
1055754034 9:79538006-79538028 CTCACAGTTTCACATGGCTAGGG - Intergenic
1056081456 9:83098650-83098672 CTCACAGTGTCACATGGCTGGGG + Intergenic
1056123666 9:83513876-83513898 CTCAGGGCTTCCCTTGGCTAGGG - Intronic
1056290224 9:85135610-85135632 CTCACAGTTTCACATGGCTGGGG - Intergenic
1056385212 9:86090985-86091007 CTCATAGTTTCCCTTGGCTAGGG + Intronic
1056404325 9:86259511-86259533 CTCACAGTGCCCCGTGGCTATGG + Intronic
1056880716 9:90390826-90390848 CTCAGAGTTACACATGGCTGGGG + Intergenic
1057283196 9:93727283-93727305 CTCAGAGTATCACATGGGTCTGG - Intergenic
1057583743 9:96311071-96311093 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1057745023 9:97744362-97744384 CTCACAGTTCCACATGGCTAGGG - Intergenic
1057845587 9:98520145-98520167 CTAAGTGTCTACCATGGCTAAGG + Intronic
1058222110 9:102314963-102314985 CTCACAGTTTCACATGGCTGGGG - Intergenic
1058322911 9:103656966-103656988 CTCACAGTTTCACATGGCTGAGG - Intergenic
1058366297 9:104213192-104213214 CTCACAGTTCCACATGGCTAGGG + Intergenic
1058367081 9:104221090-104221112 CTCAGAGGGTCCCATGCCCATGG - Intergenic
1058395524 9:104549146-104549168 CTCACAGTTTCACATGGCTGGGG - Intergenic
1058465938 9:105227465-105227487 CTGATAGCCTCCCATGGCAAGGG + Intergenic
1058592609 9:106581894-106581916 CTCACAGTCCCACATGGCTGGGG + Intergenic
1058594931 9:106605337-106605359 CTCAGAGGGTCCCATGCCCAGGG + Intergenic
1058649366 9:107160344-107160366 CTCACAGTTTCACATGGCTGGGG - Intergenic
1058753593 9:108063662-108063684 CTCACAGTTTCTCATGGCTGGGG + Intergenic
1058961366 9:109995505-109995527 CTCACAGTTCCACATGGCTAGGG + Intronic
1059195858 9:112370044-112370066 CTCACAGTTCCACATGGCTAGGG - Intergenic
1059213155 9:112533624-112533646 CTCACAGTTTCCCATTGCTGGGG + Intronic
1059540800 9:115128483-115128505 CTCACAGTTTCACATGGCTGGGG + Intergenic
1059558427 9:115306655-115306677 CTCACAGTTCCACATGGCTAGGG + Intronic
1059570941 9:115434819-115434841 CTCACAGTTTAGCATGGCTAGGG - Intergenic
1059702319 9:116787039-116787061 CTCACAGTTCCCCATGGCTGGGG - Intronic
1059843160 9:118241994-118242016 CTCACAGTTCCACATGGCTAGGG + Intergenic
1059891777 9:118812174-118812196 CTCACAGTTCCACATGGCTAGGG - Intergenic
1060021083 9:120131878-120131900 TTCACAGTTTCACATGGCTAGGG + Intergenic
1060127951 9:121067867-121067889 CTCACAGTTTCACATGGCTGGGG - Intergenic
1060567177 9:124603427-124603449 TTCAGAGTCTCCCATGTTTCAGG + Intronic
1203437651 Un_GL000195v1:156297-156319 CTCACAGTTTCACATGGCTGGGG + Intergenic
1185630407 X:1512615-1512637 CTCACAGTTCCACATGGCTAGGG + Intronic
1185973886 X:4696720-4696742 CTCACAGTTTCACATGGCTGGGG + Intergenic
1185992974 X:4912560-4912582 CTCACAGTTCCCCATGGCTGGGG - Intergenic
1186006162 X:5074741-5074763 CTCAAAGTTCCACATGGCTAGGG - Intergenic
1186017578 X:5214992-5215014 CTTAGAGTTTCACATGGCTGGGG - Intergenic
1186038931 X:5455230-5455252 CTCACAGTTTCACATGGCTGGGG - Intergenic
1186047979 X:5556826-5556848 CTCACAGTTCCCCAGGGCTAGGG - Intergenic
1186217199 X:7312740-7312762 CTCACAGTTCCACATGGCTAGGG - Intronic
1186233163 X:7478156-7478178 CTCACAGTTCCCCATGGCTGGGG + Intergenic
1186306424 X:8264653-8264675 CTCACAGTTCCACATGGCTAAGG + Intergenic
1186327352 X:8494259-8494281 CTCACAGTTTCACATGGCTGGGG + Intergenic
1186599875 X:11025023-11025045 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1186743061 X:12538194-12538216 CTCAGAGGGTCCCATGCCCACGG + Intronic
1186815495 X:13233995-13234017 CTCACAGTTTCACATGGCTGGGG + Intergenic
1186895230 X:13998536-13998558 CTCACAGTTTCGCATGGCTGGGG - Intergenic
1187002626 X:15198766-15198788 CTCACAGTTTCACATGGCTGGGG + Intergenic
1187180194 X:16936713-16936735 CTCACAGTTTCACATGGCTGGGG + Intergenic
1187290729 X:17950921-17950943 CTCACAGTTCCACATGGCTAGGG + Intergenic
1187763119 X:22609534-22609556 CTCAGAGTGTCCTATGCCCACGG + Intergenic
1188062334 X:25617236-25617258 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1188069786 X:25704776-25704798 CTCATAGTTCCACATGGCTAGGG - Intergenic
1188095737 X:26018876-26018898 CTCACAGTTCCACATGGCTAGGG - Intergenic
1188124665 X:26352543-26352565 CTCACAGTCCCACATGGCTGGGG + Intergenic
1188134767 X:26482553-26482575 CTCACAGTTTCACATGGCTAGGG - Intergenic
1188135053 X:26484484-26484506 CTCACAGTTTCACATGGCTGGGG - Intergenic
1188158807 X:26775565-26775587 CTCACAGTCCCACATGGCTGGGG - Intergenic
1188617790 X:32179915-32179937 CTCACAGTCTCACATGACTAGGG - Intronic
1188735869 X:33715070-33715092 CTCACAGTTTCACATGGCTGGGG + Intergenic
1188773813 X:34188693-34188715 CTCACAGTTTCACATGGCTGGGG + Intergenic
1188893361 X:35636590-35636612 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1188973551 X:36646520-36646542 CTCACAGTTTCACATGGCTGGGG - Intergenic
1188974007 X:36651908-36651930 CTCACAGTGTCACATGGCTGAGG + Intergenic
1188978639 X:36705962-36705984 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1188983711 X:36751021-36751043 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1189412160 X:40782010-40782032 CTCACAGTTTCACATGGCTGGGG - Intergenic
1189570311 X:42288431-42288453 CTCACAGTTTCACATGGCTGGGG + Intergenic
1189713525 X:43840703-43840725 CTCACAGCTTCCCTTGGCTAGGG - Intronic
1189940213 X:46113238-46113260 CTCACTGTCTCCCTTGGCTGAGG + Intergenic
1190466312 X:50727689-50727711 CTCACAGTTTCCCATGGCTGGGG - Intronic
1190518005 X:51244463-51244485 CTCACAGTTCCACATGGCTAGGG - Intergenic
1190649033 X:52551068-52551090 CTCAGAGGGTCCCATGCCCATGG + Intergenic
1191172090 X:57458746-57458768 CTCAGGGCTTCCCTTGGCTAGGG - Intronic
1191679884 X:63830185-63830207 CTCACAGTTTCTCATGGCTGGGG - Intergenic
1191704941 X:64084634-64084656 CTCAGAGGGTCCTATGGCCATGG - Intergenic
1191765656 X:64695616-64695638 CTCAGAGGGTCCCATGCCCATGG - Intergenic
1191812254 X:65201984-65202006 CTCAGAGTTCTGCATGGCTAAGG - Intergenic
1191848664 X:65569549-65569571 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1191931679 X:66380242-66380264 CTCACAGTTTCACATGGCTAGGG + Intergenic
1192009189 X:67250130-67250152 CTCAGGGCTTCCCTTGGCTATGG - Intergenic
1192196562 X:69032700-69032722 CTCAGAGGCTTCCCTGCCTAAGG + Intergenic
1192240986 X:69328146-69328168 CTCACAGTTCCCCATGGCTAGGG - Intergenic
1192473196 X:71417236-71417258 CTCAGAGAATCCCATGGTGAGGG - Intronic
1192685116 X:73295859-73295881 CTCACAGTTTCACATGGCTGGGG - Intergenic
1192755881 X:74046744-74046766 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1192904792 X:75539967-75539989 CTCACAGTTTCACATGGCTGTGG + Intergenic
1192980310 X:76332251-76332273 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1192999678 X:76550651-76550673 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
1193066775 X:77268498-77268520 CTCAGATACTCCCATGCCCATGG + Intergenic
1193164415 X:78264552-78264574 CTCACTGCCTCCCTTGGCTAGGG + Intergenic
1193228485 X:79013644-79013666 CTCACAGCATCCCTTGGCTAAGG + Intergenic
1193449074 X:81644417-81644439 CTCACAGTTTCCCATGGCTGGGG - Intergenic
1193452138 X:81684292-81684314 CTCAGAGGGTCCCATGCCCACGG + Intergenic
1193497326 X:82231042-82231064 CTCACAGTTCCACATGGCTAGGG - Intergenic
1193519714 X:82513317-82513339 CTCACAGTTCCACATGGCTAGGG + Intergenic
1193592503 X:83407483-83407505 CTCAGAGGGTCCCATGCCCACGG + Intergenic
1193631198 X:83890278-83890300 CTCACAGTTTCACATGGCTAGGG + Intergenic
1193725783 X:85037466-85037488 CTCACAGTTCCACATGGCTAGGG - Intronic
1193857693 X:86625647-86625669 CTCACAGTTCCACATGGCTAGGG + Intronic
1193878667 X:86895767-86895789 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1193897840 X:87135277-87135299 CTCAGAGTGCCACATGGCTGGGG + Intergenic
1193949267 X:87778325-87778347 CTCACAGCTTCCCTTGGCTAAGG - Intergenic
1193962253 X:87940170-87940192 CTCAGAGTTCCACATGGCTGGGG + Intergenic
1193969849 X:88038005-88038027 CTCACAGTTTCACATGGCTGGGG - Intergenic
1194021192 X:88694411-88694433 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1194083016 X:89491034-89491056 CTCACAGTTTCACATGGCTAGGG + Intergenic
1194106849 X:89780206-89780228 CTCATAGTTTCACATGGCTGGGG + Intergenic
1194203457 X:90983220-90983242 CTCATGGTTTCCCTTGGCTAAGG - Intergenic
1194208569 X:91040402-91040424 CTCACAGCTTCCCTTGGCTAGGG + Intergenic
1194391096 X:93319341-93319363 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1194397655 X:93405007-93405029 CTCACAGTTCCACATGGCTAGGG + Intergenic
1194445603 X:93983536-93983558 CTCAGAATGTCCCATCCCTAGGG + Intergenic
1194452835 X:94065478-94065500 CTCAGAGTTCCACATGGCTGGGG - Intergenic
1194462958 X:94195863-94195885 CTCACAGTTTCATATGGCTAGGG - Intergenic
1194463201 X:94197813-94197835 CTCACAGTTTCACATGGCTGGGG - Intergenic
1194506942 X:94744966-94744988 CTCACAGTTTACCATGGCTGTGG - Intergenic
1194603924 X:95958046-95958068 CTCACAGTTTCACATGGCTTAGG + Intergenic
1194624716 X:96214420-96214442 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1194720768 X:97337556-97337578 CCCACAGTCTCACATGGCTGGGG - Intronic
1194961112 X:100236707-100236729 CTCAGGGCTTCCCTTGGCTAGGG + Intergenic
1194963937 X:100266741-100266763 CTCACAGCTTCCCTTGGCTAGGG - Intergenic
1195215117 X:102691656-102691678 CTCAGAGGGTCCCATGCCCACGG - Intergenic
1195234243 X:102881224-102881246 CACAGAGTCCTCCATGGGTAGGG - Intergenic
1195603157 X:106771529-106771551 CTCAGAGGGTCCCATGCCCATGG - Intronic
1195640679 X:107171441-107171463 CTCACAGTTTCACATGGCTGGGG + Intronic
1195812943 X:108854003-108854025 CTCACAGTTTCACATGGCTGTGG - Intergenic
1195826768 X:109010734-109010756 CTCAGAGGGTCCCATGCCCACGG + Intergenic
1195833794 X:109089487-109089509 CTCAGGGCTTCCCTTGGCTACGG + Intergenic
1196313355 X:114195608-114195630 CTCACAGTTCCACATGGCTAAGG + Intergenic
1196326237 X:114406796-114406818 CTGACAGTTTCACATGGCTAGGG - Intergenic
1196367873 X:114943397-114943419 CTCAGAGCTTCCCTTGGCTAGGG + Intergenic
1196379750 X:115076909-115076931 CTCATAGTTCCACATGGCTAGGG - Intergenic
1196524792 X:116719577-116719599 CTCACAGTTTCACATGGCTGAGG - Intergenic
1196546884 X:116973663-116973685 CTCACAGTTTTGCATGGCTAGGG - Intergenic
1196547144 X:116975579-116975601 CTCACAGTTTCACATGGCTGGGG - Intergenic
1196548851 X:116997338-116997360 CTCACAGTTTCACATGGCTGGGG + Intergenic
1196903376 X:120408927-120408949 CTCACAGTTCCACATGGCTAGGG + Intergenic
1197109327 X:122754978-122755000 CTCACAGTTTCACATGGCTGTGG + Intergenic
1197368674 X:125599676-125599698 CTCACAGTTTCACATGGCTGGGG - Intergenic
1197379389 X:125721397-125721419 CTCACAGTTTCACATGGCTGGGG + Intergenic
1197986072 X:132267965-132267987 CCCAGATTCTCCCATGACTGAGG - Intergenic
1197995359 X:132366946-132366968 CTCACAGTTCCCCATGGCTGGGG + Intergenic
1198002344 X:132451896-132451918 CTCACAGCTTCCCTTGGCTAGGG + Intronic
1198031037 X:132753598-132753620 CTCACAGTTCCACATGGCTAGGG - Intronic
1198071643 X:133154133-133154155 CTCACAGTTTCACATGGCTGGGG - Intergenic
1198295464 X:135282715-135282737 CTCAGGGCTTCCCGTGGCTAGGG + Intronic
1198309112 X:135412749-135412771 CTCACAGTTCCACATGGCTAAGG - Intergenic
1198593505 X:138210701-138210723 CTCACAGTTTCACATGGCTGGGG + Intergenic
1198674777 X:139120173-139120195 CTCAGAGTTCCCCATGGCTGGGG - Intronic
1198723688 X:139653484-139653506 CTCAGACTCTTGCATAGCTATGG + Intronic
1198872974 X:141194887-141194909 CTCACAGTTCCACATGGCTAAGG - Intergenic
1199147197 X:144381823-144381845 CTCGCAGTTTCACATGGCTAGGG - Intergenic
1199176484 X:144793523-144793545 CTCACAGTTTCCCATGGCTAGGG + Intergenic
1199193443 X:144998326-144998348 CTCACAGTTTCACATGGCTGGGG - Intergenic
1199219540 X:145301489-145301511 CTCACAGTTTCACATGGCTGGGG - Intergenic
1199229410 X:145418629-145418651 CTCACAGTTCCACATGGCTAGGG - Intergenic
1199580647 X:149356992-149357014 CTCACAGTATCACATGGCTGGGG - Intergenic
1199968521 X:152841088-152841110 CTCGGAGGGTCCCATGGCCATGG - Intronic
1199999466 X:153050462-153050484 CTCACAGTTTCGTATGGCTAGGG - Intergenic
1200380877 X:155835595-155835617 CTCATAGTCCCACATGGCTGGGG - Intergenic
1200435668 Y:3146908-3146930 CTCACAGTTTCACATGGCTAGGG + Intergenic
1200458811 Y:3428071-3428093 CTCATAGTTTCACATGGCTGGGG + Intergenic
1200549287 Y:4558654-4558676 CTCATGGTTTCCCTTGGCTAAGG - Intergenic
1200797235 Y:7352009-7352031 CTCACAGTTTCGCATGGCTGGGG - Intergenic
1201412276 Y:13711954-13711976 CTCATAGTTCCACATGGCTAGGG - Intergenic
1201419861 Y:13786817-13786839 CTCACAGTTCCGCATGGCTAAGG + Intergenic
1201434653 Y:13943819-13943841 CTCACAGTTTCACATGGCTGGGG - Intergenic
1201682418 Y:16662147-16662169 CTCAGAGCCTCGCATGACTCTGG + Intergenic
1201683076 Y:16670508-16670530 CTCACAGTCCCTCATGGCTGGGG + Intergenic
1201711540 Y:16998227-16998249 CTCACAGTTCCACATGGCTAGGG + Intergenic
1201885320 Y:18875510-18875532 CTCACAGTTTCACATGGCTAGGG - Intergenic
1201938694 Y:19435243-19435265 CTCAGAGAGTCCCATGTCCATGG + Intergenic