ID: 969918449

View in Genome Browser
Species Human (GRCh38)
Location 4:10513121-10513143
Sequence GGGGGTTAACTAGGATATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 778
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 747}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969918449_969918457 -1 Left 969918449 4:10513121-10513143 CCTGTATATCCTAGTTAACCCCC 0: 1
1: 0
2: 0
3: 30
4: 747
Right 969918457 4:10513143-10513165 CCACAAGATTATTGGACAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 67
969918449_969918451 -9 Left 969918449 4:10513121-10513143 CCTGTATATCCTAGTTAACCCCC 0: 1
1: 0
2: 0
3: 30
4: 747
Right 969918451 4:10513135-10513157 TTAACCCCCCACAAGATTATTGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969918449 Original CRISPR GGGGGTTAACTAGGATATAC AGG (reversed) Intronic
901966427 1:12871735-12871757 GAAAGTTAACAAGGATATACAGG - Intronic
901981821 1:13041984-13042006 GAAAGTTAACAAGGATATACAGG - Intronic
902000263 1:13186929-13186951 GAAAGTTAACAAGGATATACAGG + Intergenic
902019510 1:13332693-13332715 GAAAGTTAACAAGGATATACAGG + Intergenic
902076322 1:13789779-13789801 AAGGGTTGACTAGGATATAAAGG + Intronic
902134012 1:14289224-14289246 GAAGGTTAACAAGGATATCCAGG - Intergenic
905355226 1:37378562-37378584 GAAGGTTAACAAGGATATCCAGG - Intergenic
905896837 1:41553041-41553063 GAAGGTTAACAAGGATATCCAGG - Intronic
906585985 1:46978573-46978595 GAAGGTTAACAAGGATATCCAGG + Intergenic
906736666 1:48136405-48136427 GAAGGTTAACAAGGATATCCAGG - Intergenic
907685881 1:56610642-56610664 GAAGGTTAACAAGGATATCCAGG + Intronic
908178151 1:61576919-61576941 GAAGGTTAACAAGGATATCCAGG - Intergenic
909449245 1:75780179-75780201 GAAGGTTAACAAGGATATCCAGG + Intronic
909513906 1:76486267-76486289 GAAGGTTAACAAGGATATCCAGG - Intronic
909557273 1:76968125-76968147 GAAGGTTAACAAGGATATCCAGG - Intronic
909668393 1:78161267-78161289 GAAGGTTAACAAGGATATCCAGG + Intergenic
909807667 1:79892104-79892126 GAAGGTTAACAAGGATATCCAGG - Intergenic
910281978 1:85510948-85510970 GAAGGTTAACAAGGATATCCAGG + Intronic
910336237 1:86134892-86134914 GAAGGTTAACAAGGATATCCAGG - Intronic
910339112 1:86165885-86165907 GAAGGTTAACAAGGATATCCAGG - Intergenic
910620269 1:89245728-89245750 GAAGGTTAACAAGGATATCCAGG + Intergenic
910710013 1:90169427-90169449 GAAGGTTAACAAGGATATACAGG + Intergenic
910717639 1:90249580-90249602 GAAGGTTAACAAGGATATCCAGG + Intergenic
910829364 1:91444449-91444471 GAAGGTTAACAAGGATATCCAGG + Intergenic
910915353 1:92282072-92282094 GAAGGTTAACAAGGATATCCAGG + Intronic
910954313 1:92685003-92685025 GAAGGTTAACAAGGATATCCAGG + Intronic
911342325 1:96653867-96653889 GAAGGTTAACAAGGATATCCAGG + Intergenic
911399805 1:97360402-97360424 GAAGGTTAACAAGGATATCCAGG + Intronic
911700543 1:100947596-100947618 GAGGGTTAACAAGGATGTCCAGG - Intronic
912226021 1:107734805-107734827 GAAGGTTAACAAGGATATCCAGG + Intronic
912636429 1:111298192-111298214 GAAGGTTAACAAGGATATCCAGG + Intronic
913341971 1:117767511-117767533 GAAGGTTAACAAGGATATCCAGG - Intergenic
913407785 1:118515315-118515337 GAAGGTTAACAAGGATATCCAGG - Intergenic
913410461 1:118545107-118545129 GAAGGTTAACAAGGATATCCAGG + Intergenic
913467156 1:119154818-119154840 GAAAGTTAACAAGGATATACAGG - Intergenic
914441173 1:147708530-147708552 GAAGGTTAACAAGGATATCCAGG - Intergenic
915711599 1:157904426-157904448 GAAGGTTAACAAGGATATCCAGG + Intergenic
915759898 1:158300523-158300545 GAAGGTTAACAAGGATATCCAGG - Intergenic
915975844 1:160388143-160388165 GAAGGTTAACAAGGATATCCAGG - Intergenic
916924197 1:169500282-169500304 GAAGGTTAACAAGGATATCCAGG + Intergenic
917111546 1:171554010-171554032 GAAGGTTAACAAGGATATCCAGG - Intronic
917162847 1:172077843-172077865 GAAGGTTAACAAGGATATACAGG - Intronic
917297947 1:173541457-173541479 GAAGGTTAACAAGGATATCCAGG + Intronic
917324146 1:173814281-173814303 GAAGGTTAACAAGGATATCCAGG + Intronic
917579312 1:176358464-176358486 GAAGGTTAACAAGGATATCCAGG + Intergenic
917743929 1:177988632-177988654 GAAGGTTAACAAGGATATCCAGG + Intergenic
917827637 1:178840099-178840121 GAAGGTTAACAAGGATATCCAGG + Intronic
918079884 1:181198189-181198211 GAAGGTTAACAAGGATATCCAGG + Intergenic
918159535 1:181884806-181884828 GAAGGTTAACAAGGATATTCAGG + Intergenic
918537420 1:185588983-185589005 GAGAGTTAACAAGGATATCCAGG + Intergenic
919128907 1:193430044-193430066 GAAGGTTAACAAGGATATCCAGG - Intergenic
920781324 1:208994027-208994049 GAAGGTTAACAAGGATATCCAGG + Intergenic
920960429 1:210658511-210658533 GAAGGTTAACAAGGATATCCAGG - Intronic
921004378 1:211078217-211078239 GAAGGTTAACAAGGATATTCAGG + Intronic
921288733 1:213634177-213634199 GAAGGTTAACAAGGATATCCAGG + Intergenic
923416504 1:233767694-233767716 GAAGGTTAACAAGGATATCCAGG - Intergenic
1064492630 10:15876060-15876082 GAAGGTTAACAAGGATATCCAGG - Intergenic
1064975350 10:21108705-21108727 GAAGGTTAACAAGGATATCCAGG - Intronic
1065077158 10:22091867-22091889 GAAGGTTAACAAGGATATCCAGG + Intergenic
1067326148 10:45268398-45268420 GAAGGTTAACAAGGATATCCAGG + Intergenic
1068169306 10:53372699-53372721 AAGGGTTAACAAGGATATCCAGG + Intergenic
1068239886 10:54290995-54291017 GAAGGTTAACAAGGATATCCAGG + Intronic
1068641363 10:59411874-59411896 GGAAGTTAACAAGGATATCCAGG - Intergenic
1069259800 10:66381001-66381023 GAAGGTTAACAAGGATATCCAGG + Intronic
1069734311 10:70643020-70643042 GAAGGTTAACAAGGATATCCAGG - Intergenic
1070061945 10:72992168-72992190 GAAGGTTAACAAGGATATCCAGG + Intergenic
1070852097 10:79572932-79572954 GAAGGTTAACAAGGATATCCAGG + Intergenic
1071066490 10:81642483-81642505 GAAGGTTAACAAGGATATCCAGG - Intergenic
1071193731 10:83132998-83133020 GAAGGTTAACAAGGATATCCAGG - Intergenic
1071244180 10:83744764-83744786 GAGAGTTAACAAGGATATCCAGG - Intergenic
1071698238 10:87901371-87901393 GAAGGTTAACAAGGATATCCAGG - Intronic
1071838820 10:89447205-89447227 GAAGGTTAACAAGGATATCCAGG + Intronic
1071946289 10:90648954-90648976 GAAGGTTAACAAGGATATCCAGG - Intergenic
1072091481 10:92132615-92132637 GAAGGTTAACAAGGATATCCAGG + Intronic
1072311743 10:94163199-94163221 GAAGGTTAACAAGGATATCCAGG - Intronic
1072358697 10:94637899-94637921 GAAGGTTAACAAGGATATCCAGG - Intergenic
1072364796 10:94698079-94698101 GAAGGTTAACAAGGATATCCAGG + Intronic
1072389337 10:94967230-94967252 GAAGGTTAACTAGGATCTCCAGG - Intronic
1072401633 10:95108810-95108832 GAAGGTTAACAAGGATATCCAGG - Intergenic
1072480304 10:95805032-95805054 GAAGGTTAACAAGGATATCCAGG - Intronic
1072774827 10:98180606-98180628 GAAGGTTAACAAGGATATCCAGG - Intronic
1074631221 10:115257174-115257196 AGAGGTTAACAAGGATATCCAGG - Intronic
1075805112 10:125182496-125182518 GAAGGTTAACAAGGATATCCAGG - Intergenic
1077450211 11:2637727-2637749 GGAAGTTAACAAGGATATCCAGG - Intronic
1077742013 11:4856670-4856692 GAAGGTTAACAAGGATATCCAGG + Intronic
1077969813 11:7177516-7177538 GAAGGTTAACAAGGATATTCAGG - Intergenic
1078036649 11:7812691-7812713 GAAGGTTAACAAGGATATCCAGG - Intergenic
1078284078 11:9933257-9933279 GAAGGTTAACAAGGATATCCAGG + Intronic
1078560655 11:12368560-12368582 GAAGGTTAACAAGGATATACAGG + Intergenic
1078690246 11:13572426-13572448 GAAGGTTAACAAGGATATCCAGG + Intergenic
1078981407 11:16538923-16538945 GAAGGTTAACAAGGATATCCAGG + Intronic
1079037310 11:17032045-17032067 GGAAGTTAACAAGGATATCCAGG - Intergenic
1079957761 11:26885100-26885122 GAAGGTTAACAAGGATATCCAGG + Intergenic
1079998814 11:27324050-27324072 GAAGGTTAACAAGGATATCCAGG + Intergenic
1080235603 11:30065179-30065201 GAAGGTTAACAAGGATATCCAGG - Intergenic
1080744197 11:35093239-35093261 GAAGGTTAACAAGGATATCCAGG + Intergenic
1080817946 11:35776998-35777020 GAAGGTTAACAAGGATATCCAGG - Intronic
1081143583 11:39534337-39534359 GAAGGTTAACAAGGATATCCAGG - Intergenic
1081252080 11:40848687-40848709 GAAGGTTAACAAGGATATCCAGG - Intronic
1081313426 11:41601480-41601502 GAAGGTTAACAAGGATATCCAGG + Intergenic
1081324122 11:41725340-41725362 GAAGGTTAACAAGGATATCCAGG - Intergenic
1081768497 11:45630177-45630199 GAAGGTTAACAAGGATATCCAGG + Intergenic
1082136268 11:48552920-48552942 GAGAGTTAACAAGGATATCCAGG - Intergenic
1082136685 11:48557118-48557140 GAAGGTTAACAAGGATATCCAGG - Intergenic
1082614038 11:55337015-55337037 GGAGGTTAACAAGGATATCCAGG - Intergenic
1082860459 11:57850438-57850460 GAAGGTTAACAAGGATATCCAGG + Intergenic
1083003425 11:59319008-59319030 GAAGGTTAAAAAGGATATACAGG - Intergenic
1083385256 11:62304193-62304215 GAAGGTTAACAAGGATATTCAGG - Intergenic
1083508927 11:63189088-63189110 GAAAGTTAACAAGGATATACAGG - Intronic
1083509539 11:63195202-63195224 GAATGTTAACAAGGATATACAGG + Intronic
1085536309 11:77221775-77221797 GAAGGTTAACAAGGATATCCAGG - Intronic
1085800958 11:79588702-79588724 GAAGGTTAACAAGGATATCCAGG + Intergenic
1086117556 11:83268706-83268728 GAAGGTTAACAAGGATATCCAGG + Intronic
1086298454 11:85397876-85397898 GGAGGTTAACAAGGATATCCAGG + Intronic
1086442305 11:86840558-86840580 GAAGGTTAACAAGGATATCCAGG + Intronic
1086506061 11:87505832-87505854 GAAGGTTAACAAGGATATCCAGG - Intergenic
1086612623 11:88775983-88776005 GAAGGTTAACAAGGATATCCAGG - Intronic
1086832032 11:91577864-91577886 GAAGGTTAACAAGGATATTCAGG + Intergenic
1087004937 11:93460652-93460674 GAAGGTTAACAAGGATATTCAGG + Intergenic
1087113081 11:94493290-94493312 GGGGTTTGAATAGGAAATACAGG - Intronic
1087311377 11:96547615-96547637 GAAGGTTAACAAGGATATCCAGG + Intergenic
1087753888 11:102034963-102034985 GAAGGTTAACAAGGATATCCAGG - Intergenic
1088004410 11:104923719-104923741 GAAGGTTAACAAGGATATCCAGG - Intergenic
1088309335 11:108443423-108443445 GAAGGTTAACAAGGATATCCAGG + Intronic
1088380815 11:109190907-109190929 GAAGGTTAACAAGGATATCCAGG - Intergenic
1088691105 11:112329150-112329172 GAAGGTTAACAAGGATATCCAGG - Intergenic
1088948137 11:114535880-114535902 GAAAGTTAACAAGGATATACAGG + Intronic
1089193095 11:116669315-116669337 GAAGGTTAACAAGGATATCCAGG + Intergenic
1089248536 11:117139891-117139913 GAAGGTTAACAAGGATATCCAGG + Intergenic
1090216062 11:124966184-124966206 GAAGGTTAACAAGGATATACAGG - Intronic
1090315252 11:125781134-125781156 GAAGGTTAACAAGGATATCCAGG - Intergenic
1090723226 11:129496082-129496104 GAAGGTTAACAAGGATATCCAGG + Intergenic
1090932957 11:131315128-131315150 GAAGGTTAACAAGGATATCCAGG + Intergenic
1090946770 11:131437327-131437349 GAAGGTTAACAAGGATATCCAGG - Intronic
1092532681 12:9358536-9358558 GAAGGTTAACAAGGATATCCAGG - Intergenic
1092638341 12:10476512-10476534 GGAAGTTAACAAGGATATCCAGG - Intergenic
1092994890 12:13940544-13940566 GGGGTGTAACTAGGAGATAATGG + Intronic
1093357326 12:18181965-18181987 GAGGGTTAAATAAGATATTCCGG + Intronic
1093900201 12:24623360-24623382 GAAGGTTAACAAGGATATCCAGG - Intergenic
1093983127 12:25497359-25497381 GGGGGTTAAATGGGAGAAACAGG - Intronic
1093998058 12:25663986-25664008 GAAGGTTAACAAGGATATCCAGG - Intergenic
1094127895 12:27042625-27042647 GAAGGTTAACAAGGATATCCAGG + Intronic
1094482090 12:30892577-30892599 GAAGGTTAACAAGGATATCCAGG - Intergenic
1095140793 12:38659495-38659517 ACAGGTTAACAAGGATATACAGG + Intronic
1095706215 12:45240066-45240088 GAAGGTTAACAAGGATATCCAGG - Intronic
1095720460 12:45394442-45394464 GAAGGTTAACAAGGATATCCAGG + Intronic
1095845502 12:46739569-46739591 GAAGGTTAACAAGGATATCCAGG + Intergenic
1095855068 12:46851146-46851168 GAAGGTTAACAAGGATATCCAGG + Intergenic
1095935487 12:47675843-47675865 GAAGGTTAACAAGGATATCCAGG + Intronic
1096719101 12:53507867-53507889 AGGGGTTAAGTAGGATGTCCTGG + Intronic
1096950347 12:55461909-55461931 GAAGGTTAACAAGGATATCCAGG + Intergenic
1097365480 12:58707868-58707890 GAAGGTTAACAAGGATATCCAGG - Intronic
1099313708 12:81059786-81059808 GAAGGTTAACAAGGATATCCAGG - Intronic
1099314515 12:81067175-81067197 GAAGGTTAACAAGGATATCCAGG + Intronic
1099740606 12:86629351-86629373 GAAGGTTAACAAGGATATCCAGG + Intronic
1099779363 12:87174015-87174037 GAAGGTTAACCAGGATATCCAGG + Intergenic
1100248702 12:92791721-92791743 AGAGGTTAACAAGGATATCCAGG + Intronic
1100417388 12:94392088-94392110 GAAGGTTAACAAAGATATACAGG + Intronic
1100808534 12:98313348-98313370 GAAGGTTAACAAGGATATCCAGG + Intergenic
1104086532 12:125479706-125479728 GAAGGTTAACAAGGATATCCAGG + Intronic
1104175130 12:126324191-126324213 GAAGGTTAACAAGGATATCCGGG - Intergenic
1105663607 13:22527326-22527348 GAAGGTTAACAAGGATATCCAGG + Intergenic
1105735106 13:23260087-23260109 GAAGGTTAACAAGGATATCCAGG - Intronic
1105775035 13:23651777-23651799 GCTGATTAACTAGAATATACTGG + Intronic
1106094790 13:26634033-26634055 GAAGGTTAACAAGGATATCCAGG - Intronic
1106357456 13:28997433-28997455 GAGAGTTAACAAGGATATCCAGG - Intronic
1107090259 13:36471838-36471860 GAAAGTTAACAAGGATATACAGG - Intergenic
1107439826 13:40415836-40415858 GAAGGTTAACAAGGATATCCAGG + Intergenic
1108188321 13:47910559-47910581 GAAGGTTAACAAGGATATCCAGG + Intergenic
1108549483 13:51528963-51528985 GAAGGTTAACAAGGATATCCAGG + Intergenic
1109216299 13:59593222-59593244 GAAGGTTAACAAGGATATCCAGG + Intergenic
1109806886 13:67454905-67454927 GAAGGTTAACAAGGATATGCAGG + Intergenic
1109816466 13:67590971-67590993 GAAGGTTAACAAGGATATCCAGG + Intergenic
1109964120 13:69669331-69669353 GAAGGTTAACAAGGATATCCAGG + Intergenic
1110876763 13:80519447-80519469 GAAGGTTAACAAGGATATCCAGG + Intergenic
1111712296 13:91832002-91832024 GAAGGTTAACAAGGATATTCAGG - Intronic
1111932875 13:94529238-94529260 GAAGGTTAACAAGGATATCCAGG + Intergenic
1112411754 13:99170516-99170538 GAAGGTTAACAAGGATATCCAGG - Intergenic
1113112072 13:106834087-106834109 GGGGGTTAACTGGGTGTTACTGG + Intergenic
1113348544 13:109505824-109505846 GAAGGTTAACAAGGATATCCAGG - Intergenic
1114534313 14:23413196-23413218 GGGGGGAAACTGGGATATACTGG + Intronic
1114572971 14:23687853-23687875 GAAGGTTAACAAGGATATCCAGG - Intergenic
1115184184 14:30666013-30666035 GAAGGTTAACAAGGATATCCAGG + Intronic
1115843907 14:37504204-37504226 GGAGGTTAACAAAGATATCCAGG + Intronic
1116052616 14:39823564-39823586 GAAGGTTAACAAGGATATCCAGG - Intergenic
1116165327 14:41327906-41327928 GAAGGTTAACAAGGATATCCAGG - Intergenic
1116483014 14:45414007-45414029 GAAGGTTAACAAGGATATCCAGG + Intergenic
1117123432 14:52594367-52594389 GAAGGTTAACAAGGATATCCAGG - Intronic
1117170296 14:53087259-53087281 GAAGGTTAACAAGGATATCCGGG + Intronic
1117614226 14:57517095-57517117 GAAGGTTAACAAGGATATCCAGG - Intergenic
1117822598 14:59666039-59666061 GAAGGTTAACAAGGATATCCAGG + Intronic
1117849808 14:59956180-59956202 GGAAGTTAACAAGGATATTCAGG - Intronic
1118425664 14:65658428-65658450 GGGTTTTCTCTAGGATATACAGG - Intronic
1118450304 14:65894632-65894654 GAAGGTTAACAAGGATATCCAGG + Intergenic
1118559643 14:67065476-67065498 GAAGGTTAACAAGGATATCCAGG - Intronic
1118700896 14:68432294-68432316 GAAAGTTAACTAGGATATCCAGG - Intronic
1118829722 14:69419544-69419566 GAAGGTTAACAAGGATATCCAGG - Intronic
1119093629 14:71808129-71808151 GAAGGTTAACAAGGATATTCAGG + Intergenic
1120066006 14:80041416-80041438 GAAGGTTAACAAGGATATCCAGG + Intergenic
1120084066 14:80249229-80249251 GAGAGTTAACAAGGATATCCAGG - Intronic
1120619673 14:86748547-86748569 GAAGGTTAACAAGGATATCCAGG - Intergenic
1121759381 14:96431801-96431823 GAAGGTTAACAAGGATATCCAGG - Intronic
1202846402 14_GL000009v2_random:181377-181399 GAAAGTTAACAAGGATATACAGG - Intergenic
1202915865 14_GL000194v1_random:171979-172001 GAAAGTTAACAAGGATATACAGG - Intergenic
1202876886 14_KI270722v1_random:11061-11083 GAAAGTTAACAAGGATATACAGG + Intergenic
1123884227 15:24708488-24708510 GAAGGTTAACAAGGATATTCAGG - Intergenic
1124561494 15:30777840-30777862 GAAAGTTAACTAGGATATCCAGG + Intergenic
1124669038 15:31621310-31621332 GAAAGTTAACTAGGATATCCAGG - Intronic
1125351931 15:38777128-38777150 GAAGGTTAACAAGGATATCCAGG - Intergenic
1125779251 15:42249816-42249838 GAAGGTTAACAAGGATATCCAGG - Intronic
1125837615 15:42766731-42766753 GAAGGTTAACAAGGATATCCAGG + Intronic
1126071504 15:44868727-44868749 GAAGGTTAACAAGGATATCCAGG + Intergenic
1126177947 15:45756049-45756071 GAAGGTTAACAAGGATATCCAGG - Intergenic
1126248531 15:46539787-46539809 GAAGGTTAACAAGGATATCCAGG - Intergenic
1126722252 15:51593513-51593535 GAAGGTTAACAAGGATATCCAGG + Intronic
1126854692 15:52826580-52826602 GAAGGTTAACAAGGATATCCAGG + Intergenic
1127021339 15:54751851-54751873 GAAGGTTAACAAGGATATCCAGG + Intergenic
1127168212 15:56270189-56270211 GAAGGTTAACAAGGATATCCAGG - Intronic
1127339786 15:58028998-58029020 GAAGGTTAACAAGGATATCCAGG + Intronic
1127570858 15:60239757-60239779 GAAGGTTAACAAGGATATCCAGG + Intergenic
1129020480 15:72513587-72513609 GGGGGTAAACTTGGAACTACAGG - Intronic
1129175743 15:73838661-73838683 GAAGGTTAACTATGATATAAGGG - Intergenic
1129588212 15:76889769-76889791 GAAGGTTAACAAGGATATCCAGG + Intronic
1130024243 15:80257551-80257573 TGGGGATAACTGGGATACACTGG + Intergenic
1130452861 15:84074679-84074701 GAAGGTTAACAAGGATATACAGG + Intergenic
1134033069 16:11008150-11008172 GCTGGTTACCTAGGATATAAGGG - Intronic
1134312663 16:13090345-13090367 GAAGGTTAACGAGGATATCCAGG - Intronic
1134682572 16:16136651-16136673 GGGGGTGAACAAGGAGACACCGG + Intronic
1134758276 16:16689077-16689099 GAAGGTTAACAAGGATATCCAGG + Intergenic
1134987797 16:18670100-18670122 GAAGGTTAACAAGGATATCCAGG - Intergenic
1135301530 16:21332565-21332587 GAAGGTTAACAAGGATATCCAGG - Intergenic
1137074609 16:35946285-35946307 GAAAGTTAACAAGGATATACAGG + Intergenic
1137360588 16:47811517-47811539 GAGAGTTAACAAGGATATCCAGG - Intergenic
1137371700 16:47912445-47912467 GAAGGTTAACAAGGATATCCAGG + Intergenic
1137461219 16:48665874-48665896 GAAGGTTAACAAGGATATCCAGG - Intergenic
1137471320 16:48761309-48761331 GAAGGTTAACAAGGATATCCAGG + Intergenic
1137525352 16:49230670-49230692 GAAGGTTAACAAGGATATTCAGG + Intergenic
1137799795 16:51252448-51252470 GAAAGTTAACAAGGATATACAGG - Intergenic
1137808781 16:51332387-51332409 GAAAGTTAACAAGGATATACAGG + Intergenic
1137824780 16:51482791-51482813 GAAGGTTAACAAGGATATCCAGG - Intergenic
1137890715 16:52159315-52159337 GAAGGTTAACAAGGATATCCAGG - Intergenic
1140147664 16:72326982-72327004 GAAGGTTAACAAGGATATCCAGG + Intergenic
1140569814 16:76090277-76090299 GAAAGTTAACAAGGATATACAGG - Intergenic
1142936750 17:3340808-3340830 GAAGGTTAACAAGGATATCCAGG - Intergenic
1144364881 17:14533663-14533685 GAAGGTTAACAAGGATATCCAGG - Intergenic
1145738578 17:27251797-27251819 GAAGGTTAACAAGGATATCCAGG + Intergenic
1146092711 17:29897726-29897748 GAAGGTTAACAAGGATATCCAGG + Intronic
1146145253 17:30410400-30410422 GAAGGTTAACAAGGATATCCAGG - Intronic
1148443443 17:47723903-47723925 GGGGGTTAATTAGGAAGAACTGG + Intergenic
1148950570 17:51307547-51307569 GAAGGTTAACAAGGATATCCAGG + Intergenic
1149193214 17:54088215-54088237 GGAGGTTAACAAGAATATCCAGG + Intergenic
1149196695 17:54130399-54130421 GAAGGTTAACAAGGATATCCAGG - Intergenic
1149225270 17:54463437-54463459 GAAGGTTAACAAGGATATCCAGG - Intergenic
1149240388 17:54641795-54641817 GAAGGTTAACAAGGATATCCAGG + Intergenic
1149255655 17:54823260-54823282 GAAGGTTAACAAGGATATCCAGG + Intergenic
1149359299 17:55876843-55876865 GAAGGTTAACAAGGATATCCAGG - Intergenic
1149404786 17:56337262-56337284 GAAGGTTAACAAGGATATCCAGG - Intronic
1149886296 17:60343250-60343272 GAAGGTTAACAAGGATATCCGGG + Intronic
1149901711 17:60486240-60486262 GAAGGTTAACAAGGATATCCAGG - Intronic
1150026089 17:61675615-61675637 GAAGGTTAACAAGGATATCCAGG + Intergenic
1150094360 17:62359561-62359583 GAAGGTTAACAAGGATATCCAGG + Intergenic
1154019737 18:10652550-10652572 GAAGGTTAACAAGGATATCCAGG + Intergenic
1154184472 18:12170673-12170695 GAAGGTTAACAAGGATATCCAGG - Intergenic
1154288336 18:13082148-13082170 GAAGGTTAACAAGGATATCCAGG - Intronic
1155178972 18:23326650-23326672 GAAGGTTAACAAGGATATCCAGG + Intronic
1156045876 18:32876865-32876887 GGGGGTAAACTAGTATATGGAGG - Intergenic
1156443530 18:37216673-37216695 GCAGGTTAACAAGGATATCCAGG - Intronic
1157050990 18:44164319-44164341 GAAGGTTAACAAGGATATCCGGG - Intergenic
1157561702 18:48651564-48651586 GAAGGTTAACAAGGATATCCAGG + Intronic
1157919891 18:51704157-51704179 GAAAGTTAACAAGGATATACAGG - Intergenic
1158145473 18:54307627-54307649 GAAGGTTAACAAGGATATCCAGG - Intronic
1158703946 18:59773908-59773930 GAAGGTTAACAAGGATATCCAGG + Intergenic
1160260419 18:77288890-77288912 GAAGGTTAACAAGGATATCCAGG - Intergenic
1160296236 18:77639694-77639716 GAAGGTTAACAAGGATATCCAGG + Intergenic
1162628735 19:11908270-11908292 GAAAGTTAACAAGGATATACAGG + Intronic
1163380485 19:16963641-16963663 GAAGGTTAACAAGGATATCCAGG + Intronic
1163940243 19:20485031-20485053 GAAGGTTAACAAGGATATCCAGG + Intergenic
1164085400 19:21897501-21897523 GAAGGTTAACAAGGATATCCAGG - Intergenic
1164395041 19:27855265-27855287 GAAGGTTAACAAGGATATCCAGG + Intergenic
1164406001 19:27947220-27947242 GAAGGTTAACAAGGATATCCAGG - Intergenic
1165973292 19:39651788-39651810 GAAGGTTAACAAGGATATCCAGG + Intergenic
1202673791 1_KI270710v1_random:21873-21895 GAAAGTTAACAAGGATATACAGG - Intergenic
925672925 2:6331026-6331048 GAAGGTTAACAAGGATATCCAGG - Intergenic
926642086 2:15247901-15247923 GAAGGTTAACAAGGATATCCAGG + Intronic
926648819 2:15318847-15318869 GAAGGTTAACAAGGATATCCAGG + Intronic
927028182 2:19091858-19091880 GAAGGTTAACAAGGATATCCAGG + Intergenic
927173949 2:20392327-20392349 TGAGGTTGACCAGGATATACAGG - Intergenic
927382193 2:22491748-22491770 GGGCGTTAAATAGCATTTACAGG + Intergenic
927564339 2:24097731-24097753 GAAGGTTAACAAGGATATCCAGG + Intronic
927610522 2:24534992-24535014 GAAGGTTAACAAGGATATCCAGG - Intronic
928480793 2:31681548-31681570 GAAGGTTAACAAGGATATCCAGG - Intergenic
928754432 2:34507198-34507220 GAAGGTTAACAAGGATATCCAGG + Intergenic
928900534 2:36313378-36313400 GAAGGTTAACAAGGATATCCAGG - Intergenic
930267086 2:49212392-49212414 GAAGGTTAACAAGGATATCCAGG + Intergenic
930500643 2:52212994-52213016 TGGGGTTAAATGGCATATACTGG + Intergenic
930839951 2:55835067-55835089 GAAGGTTAACAAGGATATCCAGG - Intergenic
930908668 2:56604370-56604392 GAAGGTTAACAAGGATATCCAGG - Intergenic
931204407 2:60133738-60133760 GAAGGTTAACAAGGATATCCAGG - Intergenic
931546162 2:63389994-63390016 GAAGGTTAACAAGGATATCCAGG + Intronic
931885510 2:66613159-66613181 GATGGTTAACAAGGATATCCAGG - Intergenic
931971489 2:67591506-67591528 GAAGGTTAACAAGGATATCCAGG + Intergenic
931985935 2:67742501-67742523 GAAGGTTAACAAGGATATCCCGG - Intergenic
932324170 2:70844775-70844797 GAAGGTTAACAAGGATATCCAGG + Intergenic
932328240 2:70878499-70878521 GAAGGTTAACAAGGATATCCAGG + Intergenic
932377309 2:71248959-71248981 GAAGGTTAACAAGGATATCCAGG - Intergenic
932540379 2:72645388-72645410 GAAGGTTAACAAGGATATCCAGG + Intronic
932868461 2:75372427-75372449 GAAGGTTAACAAGGATATCCAGG - Intergenic
933198383 2:79419040-79419062 GAAGGTAAACTAAGATATACTGG + Intronic
933323671 2:80809119-80809141 GAAGGTTAACAAGGATATCCAGG + Intergenic
933366478 2:81360502-81360524 GAAGGTTAACAAGGATATCCAGG - Intergenic
933443654 2:82349144-82349166 GGAGGTTAACTGGAATATAATGG + Intergenic
933607515 2:84399173-84399195 GAAGGTTAACAAGGATATCCAGG + Intergenic
934531846 2:95095324-95095346 GAAGGTTAACAAGGATATCCAGG + Intronic
934617310 2:95781051-95781073 GAAGGTTAACAAGGATATCCAGG + Intergenic
934643583 2:96043508-96043530 GAAGGTTAACAAGGATATCCAGG - Intergenic
934836991 2:97599577-97599599 GAAGGTTAACAAGGATATCCAGG - Intergenic
935495925 2:103781666-103781688 AGGGGTTTACTAGGAAAGACAGG + Intergenic
935604479 2:104957150-104957172 GAAGGTTAACAAGGATATCCAGG - Intergenic
936142884 2:109955546-109955568 GAAGGTTAACAAGGATATCCAGG + Intergenic
936179571 2:110253511-110253533 GAAGGTTAACAAGGATATCCAGG + Intergenic
936201804 2:110415921-110415943 GAAGGTTAACAAGGATATCCAGG - Intronic
937605954 2:123802098-123802120 GAAGGTTAACAAGGATATCCAGG - Intergenic
937887647 2:126911059-126911081 TGGGCTTAAATAGGATTTACTGG - Intergenic
938559194 2:132456022-132456044 GAAGGTTAACAAGGATATCCAGG - Intronic
938796400 2:134721098-134721120 GGGGATTAAATGGGATAGACTGG - Intergenic
938799683 2:134750056-134750078 GAAAGTTAACAAGGATATACAGG - Intergenic
938862100 2:135380261-135380283 GAAGGTTAACAAGGATATCCAGG + Intronic
938975305 2:136471293-136471315 GAAGGTTAACAAGGATATCCAGG + Intergenic
939019692 2:136944425-136944447 GAAGGTTAACAAGGATATCCAGG - Intronic
939193148 2:138940484-138940506 GAAGGTTAACAAGGATATCCAGG - Intergenic
939653079 2:144787864-144787886 GAAGGTTAACAAGGATATTCAGG + Intergenic
939753300 2:146075862-146075884 GAAGGTTAACAAGGATATCCAGG + Intergenic
940528011 2:154842483-154842505 GAAGGTTAACAAGGATATCCAGG - Intronic
941076668 2:161012888-161012910 GCAGGTTAACAAGGATATCCAGG + Intergenic
942392117 2:175506060-175506082 GAAGGTTAACAAGGATATCCAGG + Intergenic
942474899 2:176309435-176309457 GCAGGTTAACAAGGATATCCAGG - Intronic
942669134 2:178354685-178354707 GAAGGTTAACAAGGATATCCAGG + Intronic
942780156 2:179632149-179632171 GAAGGTTAACAAGGATATCCAGG + Intronic
942790468 2:179755475-179755497 GAAGGTTAACAAGGATATCCAGG - Intronic
942873828 2:180767700-180767722 GAAGGTTAACAAGGATATCCAGG + Intergenic
943558445 2:189432779-189432801 GAAAGTTAACTAGGATATTCAGG + Intergenic
943717031 2:191163169-191163191 AGAGGTTAACAAGGATATCCAGG + Intergenic
944164838 2:196708049-196708071 GAAGGTTAACAAGGATATCCAGG - Intronic
944393350 2:199243136-199243158 GAAGGTTAACAAGGATATCCAGG - Intergenic
944569246 2:201026412-201026434 GAAGGTTAACAAGGATATCCAGG + Intronic
945318324 2:208393868-208393890 GGGGGGAGAGTAGGATATACTGG + Intronic
945715857 2:213357299-213357321 GAAGGTTAACAAGGATATCCAGG - Intronic
945768794 2:214014556-214014578 GGAGGGTAAGTAGGATATATAGG + Intronic
945776450 2:214112354-214112376 GAAGGTTAACAAGGATATCCAGG - Intronic
946294132 2:218770200-218770222 GAGAGTTAACAAGGATATCCAGG - Intergenic
946317594 2:218928031-218928053 AGGAGTTAACTAGGTGATACAGG + Intergenic
946696612 2:222366264-222366286 GAAGGTTAACAAGGATATCCAGG - Intergenic
947483820 2:230528027-230528049 GAAGGTTAACAAGGATATCCAGG + Intronic
1168926349 20:1583357-1583379 GAGGGTGAACTTGGATATAATGG + Intronic
1169013066 20:2267059-2267081 GAAGGTTAACAAGGATATCCAGG + Intergenic
1169306852 20:4499347-4499369 GAAGGTTAACAAGGATATTCAGG - Intergenic
1170186411 20:13595824-13595846 GAAGGTTAACAAGGATATCCAGG + Intronic
1170543632 20:17413631-17413653 GAAGGTTAACAAGGATATCCAGG + Intronic
1170752605 20:19165193-19165215 GAGAGTTAACAAGGATATCCAGG - Intergenic
1171039673 20:21749215-21749237 GAAGGTTAACAAGGATATCCAGG - Intergenic
1171153930 20:22853990-22854012 GAAGGTTAACAAGGATATCCAGG + Intergenic
1171194060 20:23183436-23183458 GAAGGTTAACAAGGATATCCAGG - Intergenic
1171273877 20:23838064-23838086 GAAGGTTAACAAGGATATTCAGG + Intergenic
1171443284 20:25184373-25184395 GAAGGTTAACAAGGATATCCAGG - Intergenic
1173771548 20:45663967-45663989 GAGGGTTAACAAGGATATCCAGG - Intronic
1175509141 20:59510385-59510407 GGGGGTGAAATAGTATATGCAGG - Intergenic
1176635218 21:9186626-9186648 GAAAGTTAACAAGGATATACAGG - Intergenic
1176928691 21:14781510-14781532 GAAGGTTAACAAGGATATCCAGG + Intergenic
1177025899 21:15921058-15921080 GAAGGTTAACAAGGATATCCAGG - Intergenic
1177122412 21:17154330-17154352 GAAGGTTAACAAGGATATCCAGG + Intergenic
1177943130 21:27435507-27435529 GGAAGTTAACAAGGATATCCAGG - Intergenic
1179254035 21:39699661-39699683 GGGAGGTAACTAGGATATGAGGG - Intergenic
1180422189 22:12875999-12876021 GAAAGTTAACAAGGATATACAGG + Intergenic
1180541255 22:16449812-16449834 GAAGGTTAACAAAGATATACTGG + Intergenic
1180640747 22:17297155-17297177 GAAGGTTAACAAGGATATCCAGG - Intergenic
1180724257 22:17933069-17933091 GAAGGTTAACCAGGATATCCAGG + Intronic
1181326660 22:22054812-22054834 GAAGGTTAACAAGGATATCCAGG - Intergenic
1181445477 22:22969619-22969641 GAAGGTTAACAAGGATATCCAGG + Intergenic
1182152231 22:28036089-28036111 GAAGGTTAACAAGGATATCCAGG + Intronic
949245019 3:1917032-1917054 GAAGGTTAACAAGGATATCCAGG - Intergenic
949717312 3:6948598-6948620 GAAAGTTAACAAGGATATACAGG - Intronic
949800257 3:7896358-7896380 GAAGGTTAACAAGGATATCCAGG - Intergenic
949804254 3:7936815-7936837 GAAGGTTAACAAGGATATCCAGG + Intergenic
950834948 3:15910780-15910802 GGAAGTTAACAAGGATATCCAGG - Intergenic
950862502 3:16162386-16162408 GGAAGTTAACAAGGATATCCAGG - Intergenic
951439814 3:22709495-22709517 GAAGGTTAACAAGGATATCCAGG + Intergenic
951471356 3:23060141-23060163 GAAGGTTAACAAGGATATCCAGG - Intergenic
951759314 3:26128042-26128064 GAAGGTTAACAAGGATATCCAGG - Intergenic
951985963 3:28621184-28621206 GAAGGTTAACAAGGATATCCAGG + Intergenic
952550326 3:34469843-34469865 GAAGGTTAACAAGGATATCCAGG - Intergenic
952632005 3:35480909-35480931 GAAAGTTAACAAGGATATACAGG - Intergenic
952813749 3:37428897-37428919 GAAGGTTAACAAGGATATCCAGG - Intronic
952864205 3:37840828-37840850 GAAGGTTAACAAGGATATCCAGG + Intergenic
953254904 3:41280257-41280279 GAAGGTTAACAAGGATATCCAGG + Intronic
953275557 3:41493026-41493048 GAAAGTTAACAAGGATATACAGG + Intronic
953281484 3:41562404-41562426 GAAGGTTAACAAGGATATCCAGG - Intronic
955282671 3:57608836-57608858 GGAAGTTAACAAGGATATCCAGG + Intergenic
955361416 3:58279144-58279166 GAAGGTTAACAAGGATATCCAGG - Intronic
955464670 3:59224372-59224394 GAAGGTTAACAAGGATATCCAGG - Intergenic
955642721 3:61103597-61103619 GAAGGTTAACAAGGATATCCAGG - Intronic
956317133 3:67950385-67950407 GAAGGTTAACAAGGATATCCAGG + Intergenic
956477164 3:69634897-69634919 GAAGGTTAACAAGGATATCCAGG - Intergenic
957670069 3:83289985-83290007 GAAGGTTAACAAGGATATACAGG - Intergenic
957917616 3:86706871-86706893 GAAGGTTAACAAGGATATATAGG - Intergenic
958011474 3:87884939-87884961 GAAGGTTAACAAGGATATCCAGG + Intergenic
958448198 3:94240678-94240700 GAAGGTTAACAAGGATATCCAGG - Intergenic
958849177 3:99303106-99303128 GAAGGTTAACAAGGATATCCAGG + Intergenic
958873730 3:99591469-99591491 GACGGTTAACAAGGATATACAGG + Intergenic
959004647 3:101006709-101006731 GAAGGTTAACAAGGATATCCAGG - Intergenic
959041848 3:101431223-101431245 GAAGGTTAACAAGGATATCCAGG - Intronic
959723719 3:109521002-109521024 GAAGGTTAACAAGGATATCCAGG - Intergenic
959736714 3:109667336-109667358 GAAGGTTAACAAGGATATCCAGG + Intergenic
960508333 3:118519345-118519367 GAGGGTTAACAAGGATATCCAGG + Intergenic
960734382 3:120762257-120762279 GAAGGTTAACAAGGATATCCAGG - Intronic
960784183 3:121354224-121354246 GAAGGTTAACAAGGATATCCAGG - Intronic
960787451 3:121389929-121389951 GAAGGTTAACAAGGATATCCAGG - Intronic
960832125 3:121861213-121861235 GAAGGTTAACAAGGATATACAGG - Intronic
960835807 3:121905891-121905913 GAAGGTTAACAAGGATATACAGG - Intronic
960890852 3:122446120-122446142 GAAGGTTAACAAGGATATCCAGG + Intronic
962136882 3:132744694-132744716 GAAGGTTAACAAGGATATCCAGG - Intergenic
962190926 3:133310245-133310267 GAAGGTTAACAAGGATATCCGGG - Intronic
962341235 3:134585735-134585757 GAAGGTTAACAAGGATATCCAGG - Intergenic
962602565 3:137005308-137005330 GAAGGTTAACAAGGATATCCAGG - Intronic
962624702 3:137213625-137213647 GAAGGTTAACAAGGATATGCAGG + Intergenic
962634577 3:137317782-137317804 GAAGGTTAACAAGGATATCCAGG - Intergenic
962641819 3:137395111-137395133 AGAGGTTAACAAGGATATCCAGG + Intergenic
962656222 3:137546231-137546253 GAAGGTTAACAAGGATATCCAGG + Intergenic
962675425 3:137753295-137753317 GAAGGTTAACAAGGATATCCAGG + Intergenic
962767219 3:138576550-138576572 GAAGGTTAACAAGGATATCCAGG + Intronic
962819132 3:139030334-139030356 GAAAGTTAACAAGGATATACAGG - Intronic
962861553 3:139407177-139407199 GAAGGTTAACAAGGATATCCAGG + Intergenic
962913844 3:139880991-139881013 GAAGGTTAACAAGGATATCCAGG - Intergenic
962931896 3:140046060-140046082 GAAAGTTAACAAGGATATACAGG - Intronic
963048253 3:141120454-141120476 GAAGGTTAACAAGGATATCCAGG - Intronic
963846834 3:150167787-150167809 GGGGGTTAGCTTGGAGACACTGG - Intergenic
964356080 3:155853377-155853399 GGGCGTTAACTATGTTATCCAGG - Exonic
964782997 3:160361474-160361496 GAAGGTTAACAAGGATATCCAGG + Intronic
965163611 3:165167337-165167359 GAAGGTTAACAAGGATATTCAGG - Intergenic
966477809 3:180369960-180369982 GAAGGTTAACAAGGATATCCAGG + Intergenic
966582911 3:181588935-181588957 GAAGGTTAACAAGGATATCCAGG - Intergenic
969807439 4:9620506-9620528 GAAGGTTAACAAGGATATCCAGG + Intergenic
969918449 4:10513121-10513143 GGGGGTTAACTAGGATATACAGG - Intronic
970278093 4:14424083-14424105 GAAAGTTAACAAGGATATACAGG - Intergenic
970470219 4:16370813-16370835 GAAGGTTAACAAGGATATCCAGG - Intergenic
970791768 4:19866362-19866384 GAAGGTTAACAAGGATATCCAGG - Intergenic
971437491 4:26643025-26643047 GAAGGTTAACAAGGATATCCAGG + Intronic
971466920 4:26973781-26973803 GAAGGTTAACAAGGATATCCAGG - Intronic
972196421 4:36658625-36658647 GAAGGTTAACAAGGATATCCAGG + Intergenic
972685854 4:41352053-41352075 GAAGGTTAACAAGGATATCCAGG + Intergenic
972859617 4:43151483-43151505 GAAGGTTAACAACGATATACAGG - Intergenic
972898828 4:43656931-43656953 GAGAGTTAACAAGGATATCCAGG + Intergenic
973137457 4:46725805-46725827 GAAGGTTAACAAGGATATCCAGG - Intergenic
973341597 4:49011019-49011041 GAAGGTTAACAAGGATATCCAGG - Intronic
973871101 4:55167633-55167655 GAAGGTTAACAAGGATATCCAGG - Intergenic
973875010 4:55208767-55208789 GAAGGTTAACAAGGATATCCAGG + Intergenic
973883796 4:55299731-55299753 GAAGGTTAACAAGGATATCCAGG + Intergenic
973921743 4:55693408-55693430 GAAGGTTAACAAGGATATCCAGG + Intergenic
974151142 4:58010797-58010819 GGAGGTTAACAAGGATATCCAGG - Intergenic
974176895 4:58335913-58335935 GAAGGTTAACAAGGATATCCAGG + Intergenic
974177223 4:58339674-58339696 GAAGGTTAACAAGGATATCCAGG + Intergenic
974567146 4:63592200-63592222 GAAGGTTAACAAGGATATCCAGG + Intergenic
974654563 4:64802058-64802080 GAAGGTTAACAAGGATATCCAGG + Intergenic
974954504 4:68621353-68621375 GAAGGTTAACAAGGATATCCAGG + Intronic
975203501 4:71618412-71618434 GAAGGTTAACAAGGATATCCAGG + Intergenic
975449536 4:74507922-74507944 GAAGGTTAACAAGGATATCCAGG + Intergenic
975500325 4:75077771-75077793 GAAGGTTAACAAGGATATCCAGG - Intergenic
975528963 4:75380706-75380728 GAAGGTTAACAAGGATATCCAGG + Intergenic
976451129 4:85192543-85192565 GAAGGTTAACAAGGATATCCAGG - Intergenic
976477708 4:85504260-85504282 GAAGGTTAACAAGGATATCCAGG - Intronic
976506232 4:85850992-85851014 GAAGGTTAACAAGGATATCCAGG - Intronic
976760308 4:88541540-88541562 GAAGGTTAACAAGGATATTCAGG + Intronic
976975638 4:91163474-91163496 GAAGGTTAACAAGGATATCCAGG - Intronic
977511442 4:97967456-97967478 GAAGGTTAACAAGGATATCCAGG + Intronic
977744422 4:100528769-100528791 GGATGTTAACAAGGATATCCAGG - Intronic
978006880 4:103627742-103627764 GAAGGTTAACAAGGATATCCAGG + Intronic
978140295 4:105310787-105310809 GGAAGTTAACAAGGATATCCAGG - Intergenic
978205074 4:106071641-106071663 GAAGGTTAACAAGGATATCCAGG - Intronic
978363820 4:107959263-107959285 GGAAGTTAACAAGGATATCCAGG + Intergenic
978929174 4:114289634-114289656 GAAGGTTAACAAGGATATCCAGG + Intergenic
979272611 4:118780644-118780666 GAAGGTTAACAAGGATATCCAGG - Intronic
979310756 4:119200259-119200281 GAAGGTTAACAAGGATATCCAGG + Intronic
979344967 4:119576285-119576307 GAGAGTTAACAAGGATATCCAGG + Intronic
979462457 4:120999571-120999593 GAAGGTTAACAAGGATATCCAGG - Intergenic
979516812 4:121618822-121618844 GAAGGTTAACAAGGATATCCAGG + Intergenic
979581633 4:122367375-122367397 GAAGGTTAACAAGGATATCCAGG + Intergenic
979750443 4:124272910-124272932 GAAGGTTAACAAGGATATCCAGG - Intergenic
979757853 4:124363822-124363844 GAAGGTTAACAAGGATATCCAGG + Intergenic
980558502 4:134440684-134440706 GAAGGTTAACAAGGATATCCAGG - Intergenic
980593771 4:134926555-134926577 GAAGGTTAACAAGGATATCCAGG - Intergenic
981255022 4:142650819-142650841 GAAGGTTAACAAGGATATCCAGG + Intronic
981446057 4:144839268-144839290 GAAGATTAACTAGGATATCCAGG + Intergenic
981479774 4:145226621-145226643 GAAGGTTAACAAGGATATTCAGG - Intergenic
981496568 4:145400385-145400407 GAAGGTTAACAAGGATATCCAGG - Intergenic
981512931 4:145576935-145576957 GAAGGTTAACAAGGATATCCAGG + Intergenic
981796055 4:148596818-148596840 GAAGGTTAACAAGGATATTCAGG - Intergenic
982327868 4:154148126-154148148 GAAGGTTAACAAGGATATCCAGG - Intergenic
982785441 4:159531579-159531601 GATGGTTAACAAGGATATCCAGG - Intergenic
983948710 4:173615080-173615102 GAAGGTTAACAAGGATATCCAGG - Intergenic
984433807 4:179683158-179683180 GAATGTTAACAAGGATATACAGG - Intergenic
985367118 4:189243533-189243555 GAAGGTTAACAAGGATATCCAGG - Intergenic
1202753048 4_GL000008v2_random:26919-26941 GAAAGTTAACAAGGATATACAGG + Intergenic
986656126 5:10014558-10014580 GAAGGTTAACAAGGATATCCAGG - Intergenic
987180150 5:15358716-15358738 GAAGGTTAACAAGGATATCCAGG + Intergenic
988187597 5:27887416-27887438 GAAGGTTAACAAGGATATCCGGG - Intergenic
988223112 5:28375182-28375204 AGGGATTAACTAGGATATCTGGG - Intergenic
988687859 5:33542461-33542483 GAAGGTTAACAAGGATATCCAGG + Intronic
988770888 5:34432292-34432314 GAAGGTTAACAAGGATATCCAGG - Intergenic
988794868 5:34644219-34644241 GAAGGTTAACAAGGATATGCAGG - Intergenic
988975422 5:36510630-36510652 GAAGGTTAACAAGGATATCCAGG + Intergenic
989087515 5:37691309-37691331 GAAGGTTAACAAGGATATCCAGG + Intronic
989357832 5:40564925-40564947 GAAGGTTAACAAGGATATCCAGG - Intergenic
990230066 5:53703726-53703748 GAGGGTTAACAAGGATATCCAGG - Intergenic
990234678 5:53754040-53754062 GAAGGTTAACAAGGATATCCAGG + Intergenic
990239439 5:53801905-53801927 GAAGGTTAACAAGGATATCCAGG + Intergenic
990244625 5:53852231-53852253 GAAGGTTAACAAGGATATCCAGG - Intergenic
990369152 5:55099114-55099136 GAAGGTTAACAAGGATATCCAGG + Intergenic
990916696 5:60914134-60914156 GAAGGTTAACAAGGATATCCAGG - Intronic
991004646 5:61815757-61815779 GGGGGTTGATTGGGATGTACAGG - Intergenic
991199760 5:63978433-63978455 GAAGGTTAACAAGGATATCCAGG - Intergenic
991224818 5:64257838-64257860 GAAAGTTAACAAGGATATACAGG + Intronic
991242073 5:64471679-64471701 GAAGGTTAACAAGGATATCCAGG + Intergenic
991529696 5:67601870-67601892 GAAGGTTAACAAGGATATCCAGG - Intergenic
991634863 5:68694170-68694192 GAAGGTTAACAAGGATATCCAGG + Intergenic
992516946 5:77503474-77503496 GAAGGTTAACAAGGATATCCAGG + Intronic
992580738 5:78173300-78173322 GAAGGTTAACAAGGATATCCAGG - Intronic
992604184 5:78438757-78438779 GAAGGTTAACAAGGATATCCAGG - Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
992700707 5:79339271-79339293 GAAGGTTAACAAGGATATCCAGG - Intergenic
992854262 5:80844442-80844464 GAAGGTTAACAAGGATATCCAGG - Intronic
993043861 5:82845595-82845617 GAAGGTTAACAAGGATATCCAGG - Intergenic
993358082 5:86939894-86939916 GAAGGTTAACAAGGATATGCAGG - Intergenic
993366495 5:87040580-87040602 GAAGGTTAACAAGGATATCCAGG - Intergenic
993471101 5:88308329-88308351 GAAGGTTAACAAGGATATCCAGG + Intergenic
993474592 5:88349224-88349246 GAAGGTTAACAAGGATATCCAGG - Intergenic
993497187 5:88620988-88621010 GAAGGTTAACAAGGATATCCAGG - Intergenic
993591809 5:89803473-89803495 GAGGCTTAACAAGGATATCCAGG + Intergenic
993656067 5:90579649-90579671 GAAGGTTAACAAGGATATCCAGG - Intronic
993656739 5:90586964-90586986 GGAGTTTACCTAGGATAGACAGG + Intronic
994039995 5:95247934-95247956 GAAGGTTAACAAGGATATCCAGG - Intronic
994288077 5:97993903-97993925 GGAAGTTAACAAGGATATCCAGG + Intergenic
994308538 5:98238230-98238252 GAAGGTTAACAAGGATATCCAGG - Intergenic
994581317 5:101646321-101646343 GAAGGTTAACAAGGATATCCAGG - Intergenic
994586297 5:101713788-101713810 GAAGGTTAACAAGGATATCCAGG - Intergenic
995489588 5:112677022-112677044 GAAGGTTAACAAGGATATCCAGG - Intergenic
995563979 5:113414311-113414333 GAAGGTTAACAAGGATATTCAGG - Intronic
995670841 5:114600618-114600640 GAAGGTTAACAAGGATATCCAGG + Intergenic
996147055 5:119989685-119989707 GAAGGTTAACAAGGATATCCAGG - Intergenic
996274499 5:121648218-121648240 GAAGGTTAACAAGGATATTCAGG - Intergenic
996668503 5:126088561-126088583 GAACGTTAACTAGGATATCCAGG + Intergenic
996983773 5:129534138-129534160 GGTAGTTAACAAGGATATCCAGG - Intronic
997097197 5:130926152-130926174 GAAGGTTAACAAGGATATCCAGG + Intergenic
997187422 5:131896428-131896450 GAAGGTTAACAAGGATATCCAGG - Intronic
997245720 5:132347307-132347329 GAAGGTTAACAAGGATATCCAGG - Intergenic
997343661 5:133168749-133168771 GAAGGTTAACAAGGATATCCAGG - Intergenic
997797606 5:136826564-136826586 GAGAGTTAACAAGGATATCCAGG - Intergenic
998802100 5:145879650-145879672 GAAGGTTAACAAGGATATCCAGG + Intergenic
999559985 5:152790152-152790174 GAAGGTTAACAAGGATATCCAGG + Intergenic
999965884 5:156808756-156808778 GAAGGTTAACAAGGATACACAGG + Intergenic
1000214538 5:159142147-159142169 GAAGGTTAACAAGGATATCCAGG + Intergenic
1002306966 5:178289284-178289306 GTGGATTAACTGGGATTTACCGG + Intronic
1003165628 6:3675750-3675772 GAAGGTTAACAAGGATATCCAGG - Intergenic
1003542403 6:7029430-7029452 GAAGGTTAACAAGGATATCCAGG + Intergenic
1003647748 6:7928282-7928304 GAAGGTTAACAAGGATATCCAGG + Intronic
1003974615 6:11330461-11330483 AGGGGCTAACTAGGATACACTGG + Intronic
1003987808 6:11454415-11454437 GAAGGTTAACAAGGATATCCAGG + Intergenic
1005747442 6:28851364-28851386 GAAGGTTAACAAGGATATTCAGG + Intergenic
1006616856 6:35334551-35334573 GAAGGTTAACAAGGATATCCAGG + Intergenic
1008094993 6:47330436-47330458 GAAGGTTAACAAGGATATCCAGG + Intergenic
1008363336 6:50647573-50647595 GAAGGTTAACAAGGATATCCAGG - Intergenic
1009655858 6:66543502-66543524 GAAGGTTAACAAGGATATCCAGG + Intergenic
1009679459 6:66873297-66873319 GAAGGTTAACAAGGATATCCAGG - Intergenic
1009998919 6:70927784-70927806 GAAGGTTAACAAGGATATCCAGG + Intronic
1011213755 6:84982639-84982661 GAAGGTTAACAAGGATATCCAGG + Intergenic
1011244271 6:85305758-85305780 GAAGGTTAACAAGGATATCCAGG - Intergenic
1011336748 6:86270071-86270093 GAAGGTTAACAAGGATATCCAGG - Intergenic
1011417996 6:87142279-87142301 GAAGGTTAACAAGGATATCCAGG + Intergenic
1011884863 6:92080888-92080910 GAAGGTTAACAAGGATATCCAGG + Intergenic
1011909946 6:92423347-92423369 GAAGGTTAACAAGGATATCCAGG + Intergenic
1012209042 6:96497812-96497834 GAAGGTTAACAAGGATATACAGG - Intergenic
1012585022 6:100911665-100911687 GAAGGTTAACAAGGATATCCAGG - Intergenic
1014938306 6:127410149-127410171 GAAGGTTAACAAGGATATCCAGG - Intergenic
1015046044 6:128777741-128777763 GAAGGTTAACAAGGATATCCAGG - Intergenic
1015131112 6:129810567-129810589 GAAGGTTAACAAGGATATCCAGG - Intergenic
1015133270 6:129838020-129838042 GAAGGTTAACAAGGATATCCAGG + Intronic
1015197635 6:130541187-130541209 GAAGGTTAACAAGGATATCCGGG + Intergenic
1015967465 6:138709454-138709476 TAGGGTTAACAAGGATATCCAGG - Intergenic
1016005772 6:139087961-139087983 GAAGGTTAACAAGGATATCCAGG - Intergenic
1016102300 6:140117323-140117345 GAAGGTTAACAAGGATATCCAGG + Intergenic
1016436630 6:144044717-144044739 GAAGGTTAACAAGGATATCCAGG - Intronic
1017231831 6:152081073-152081095 GAAGGTTAACAAGGATATCCAGG + Intronic
1017279878 6:152611595-152611617 GAAGGTTAACAAGGATATCCAGG + Intronic
1017303131 6:152885238-152885260 GAAGGTTAACAAGGATATCCAGG + Intergenic
1017660171 6:156666100-156666122 GAAGGTTAACAAGGATATCCAGG + Intergenic
1018075801 6:160212265-160212287 GAAGGTTAACAAGGATATCCAGG - Intronic
1020443333 7:8242014-8242036 GAAGGTTAACAAGGATATCCAGG + Intronic
1020833797 7:13124372-13124394 GAAGGTTAACAAGGATATCCAGG - Intergenic
1020928029 7:14357139-14357161 GAAGGTTAACAAGGATATCCAGG - Intronic
1021306398 7:19037777-19037799 GGAGGTTAACAAGGATATCCAGG - Intronic
1021460996 7:20886963-20886985 GAAGGTTAACAAGGATATCCAGG - Intergenic
1021755459 7:23847142-23847164 GAAGGTTAACAAGGATATCCAGG + Intergenic
1021797932 7:24276528-24276550 GAAGGTTAACAAGGATATCCAGG - Intergenic
1021870312 7:24999793-24999815 GAAGGTTAACAAGGATATCCAGG - Intergenic
1022900130 7:34800165-34800187 GAAGGTTAACAAGGATATTCAGG + Intronic
1022901665 7:34816515-34816537 GAAGGTTAACAAGGATATTCAGG + Intronic
1023065813 7:36376634-36376656 GAAGGTTAACAAGGATATCCAGG - Intronic
1024129835 7:46339824-46339846 GAAGGTTAACAAGGATATTCAGG - Intergenic
1024379041 7:48673256-48673278 GAAGGTTAACAAGGATATCCAGG + Intergenic
1024380238 7:48687527-48687549 GGAGGTTAACAAGGATATCCAGG + Intergenic
1024817247 7:53285869-53285891 GAAGGTTAACAAGGATATCCAGG - Intergenic
1024956030 7:54921907-54921929 GAAGGTTAACAAGGATATCCAGG - Intergenic
1025720785 7:64010787-64010809 GAAGGTTAACAAGGATATCCAGG - Intergenic
1027727611 7:81827577-81827599 GAAGTTTAACAAGGATATACAGG - Intergenic
1028114743 7:86984284-86984306 GAAGGTTAACAAGGATATCCAGG + Intronic
1028139805 7:87261365-87261387 GGAGGTTAACAAGGATATCCAGG - Intergenic
1028412755 7:90548935-90548957 GAAGGTTAACAAGGATATCCAGG - Intronic
1028802740 7:94985366-94985388 GAAGGTTAACAAGGATATCCAGG - Intronic
1029006290 7:97213582-97213604 GATGGTTAACAAGGATATCCAGG - Intergenic
1029053115 7:97710556-97710578 GAAGGTTAACAAGGATATACAGG - Intergenic
1029801737 7:102954990-102955012 GAAGGTTAACAAGGATATCCAGG + Intronic
1029810309 7:103040423-103040445 GAAGGTTAACAAGGATATCCAGG + Intronic
1029902955 7:104061390-104061412 GAAGGTTAACAAGGATATCCAGG + Intergenic
1029951728 7:104593582-104593604 GAAGGTTAACAAGGATATCCAGG - Intronic
1030029963 7:105359921-105359943 GAAGGTTAACGAGGATATCCAGG - Intronic
1030970539 7:116049577-116049599 GAAAGTTAACAAGGATATACAGG + Intronic
1031366218 7:120903299-120903321 GAAGGTTAACAAGGATATCCAGG + Intergenic
1031391813 7:121224502-121224524 GAAGGTTAACAAGGATATCCAGG - Intronic
1031612305 7:123842540-123842562 GAAGGTTAACAAGGATATCCAGG - Intronic
1031803780 7:126281362-126281384 GAAGGTTAACAAGGATATCCAGG - Intergenic
1032250448 7:130252561-130252583 GAAGGTTAACGAGGATATCCAGG - Intergenic
1032603443 7:133324753-133324775 GAAAGTTAACAAGGATATACAGG - Intronic
1034039865 7:147866462-147866484 GAAGGTTAACAAGGATATCCAGG - Intronic
1034394432 7:150810153-150810175 GAAGGTTAACAAGGATATCCAGG + Intergenic
1037398575 8:18469509-18469531 GAAGGTTAACAAGGATATCCAGG + Intergenic
1039036284 8:33362869-33362891 GAAGGTTAACAAGGATATCCAGG + Intergenic
1039347934 8:36728354-36728376 GAAGGTTAACAAGGATATCCAGG + Intergenic
1039633803 8:39141733-39141755 GAAGGTTAACAAGGATATCCAGG - Intronic
1040013852 8:42684357-42684379 GAAGGTTAACAAGGATATCCAGG + Intergenic
1040411032 8:47154311-47154333 GAAGGTTAACAAGGATATCCAGG + Intergenic
1040473648 8:47758108-47758130 GAAGGTTAACAAGGATATTCAGG - Intergenic
1040569300 8:48593614-48593636 GCTGGTGAGCTAGGATATACTGG - Intergenic
1041213244 8:55573858-55573880 GAAGGTTAACAAGGATATCCAGG + Intergenic
1041253446 8:55957433-55957455 GGAGGTTAATCAGGATGTACTGG + Intronic
1041634517 8:60128206-60128228 GAAGGTTAACAAGGATATCCAGG - Intergenic
1041910100 8:63079768-63079790 GAAGGTTAACGAGGATATCCAGG + Intronic
1042023996 8:64403407-64403429 GAAGGTTAACAAGGATATCCAGG - Intergenic
1042217226 8:66438748-66438770 GGGGGAGGACTAGGAAATACAGG + Intronic
1042308469 8:67356481-67356503 GAAGGTTAACAAGGATATCCAGG - Intergenic
1042833703 8:73058346-73058368 GAAGGTTAACAAGGATATCCAGG + Intergenic
1042853260 8:73238385-73238407 GAAGGTTAACAAGGATATCCGGG - Intergenic
1042931537 8:74018521-74018543 GAAGGTTAACAAGGATATCCAGG + Intronic
1043088953 8:75873920-75873942 GAAGGTTAACAAGGATATCCAGG - Intergenic
1043129170 8:76439956-76439978 GAAGGTTAACAAGGATATCCAGG - Intergenic
1043165616 8:76899619-76899641 GAAGGTTAACAAGGATATCCAGG - Intergenic
1043244181 8:77977282-77977304 GAAGGTTAACAAGGATATCCAGG - Intergenic
1043828212 8:84954966-84954988 GAAGGTTAACAAGGATATCCAGG - Intergenic
1043844830 8:85152278-85152300 GAAGGTTAACAAGGATATCCAGG + Intergenic
1044314340 8:90732299-90732321 GAAGGTTAACAAGGATATCCAGG - Intronic
1044448952 8:92311726-92311748 GAAGGTTAACAAGGATATCCAGG - Intergenic
1044596784 8:93967374-93967396 GAAGGTTAACAAGGATATCCAGG - Intergenic
1044615377 8:94135202-94135224 GAAGGTTAACAAGGATATCCAGG - Intronic
1044956371 8:97485653-97485675 GAAGGTTAACAAGGATATCCAGG - Intergenic
1045164729 8:99590879-99590901 GAAGGTTAACGAGGATATCCAGG - Intronic
1045607357 8:103792019-103792041 GGAAGTTAACAAGGATATCCAGG + Intronic
1046047712 8:108984153-108984175 GAAGGTTAACAAGGATATCCAGG - Intergenic
1046435926 8:114189559-114189581 GAAGGTTAACAAGGATATCCAGG + Intergenic
1046608154 8:116393328-116393350 GAAGGTTAACAAGGATATCCAGG + Intergenic
1046879000 8:119287866-119287888 GAAGGTTAACAAGGATATCCAGG - Intergenic
1046881137 8:119309364-119309386 GAAGGTTAACAAGGATATCCAGG + Intergenic
1047129587 8:122003852-122003874 GAAGGTTAACAAGGATATCCAGG + Intergenic
1047473195 8:125199719-125199741 GAAGGTTAACAAGGATATCCAGG - Intronic
1047887095 8:129263603-129263625 GGGGGTTGAATAGGATTTCCTGG - Intergenic
1048149560 8:131881244-131881266 GAAGGTTAACAAGGATATCCAGG - Intergenic
1049485083 8:142852531-142852553 GAAGGTTAACAAGGATATCCAGG + Intronic
1050320954 9:4451447-4451469 GAAGGTTAACAAGGATATCCAGG + Intergenic
1050387247 9:5103519-5103541 GAAGGTTAACAAGGATATCCAGG + Intronic
1050407976 9:5329858-5329880 GAAGGTTAACAAGGATATCCAGG + Intergenic
1050590830 9:7158884-7158906 GAAGGTTAACAAGGATATCCAGG - Intergenic
1050603911 9:7281228-7281250 GAAGGTTAACAAGGATATCCAGG - Intergenic
1050645562 9:7715498-7715520 GAAGGTTAACAAGGATATCCAGG + Intergenic
1051205327 9:14682635-14682657 GGAAGTTAACAAGGATATCCAGG + Intronic
1051303096 9:15674903-15674925 GAAGGTTAACAAGGATATCCAGG - Intronic
1052106569 9:24524582-24524604 GAAAGTTAACAAGGATATACAGG - Intergenic
1052132098 9:24860384-24860406 GAAAGTTAACAAGGATATACAGG + Intergenic
1052217568 9:25985161-25985183 AGAGGTTAACGAGGATATCCAGG + Intergenic
1052770743 9:32686713-32686735 GAAGGTTAACAAGGATATCCAGG + Intergenic
1053751498 9:41261525-41261547 GAAGGTTAACAAGGATATCCAGG - Intergenic
1054334279 9:63789649-63789671 GAAGGTTAACAAGGATATCCAGG + Intergenic
1054799164 9:69329864-69329886 GGGAGTTAACTAGGTTCCACTGG + Intronic
1054799174 9:69329912-69329934 GGGAGTTAACTAGGTTCCACTGG + Intronic
1054799190 9:69329994-69330016 GGGAGTTAACTAGGTTCCACTGG + Intronic
1054799206 9:69330076-69330098 GGGAGTTAACTAGGTTCCACTGG + Intronic
1054997601 9:71409706-71409728 GAAGGTTAACAAGGATATCCAGG + Intronic
1056348217 9:85721209-85721231 GAAGGTTAACAAGGATATCCAGG - Intronic
1056417671 9:86392568-86392590 GGAGGTTAACAAGGATATCCAGG + Intergenic
1057697746 9:97338705-97338727 GAAGGTTAACAAGGATATCCAGG - Intronic
1057768844 9:97948892-97948914 GAAGGTTAACAAGGATATCCAGG - Intergenic
1058925884 9:109663730-109663752 GAAGGTTAACAAGGATATCCAGG - Intronic
1060037882 9:120273608-120273630 GAAGGTTAACAAGGATATCCAGG - Intergenic
1060133701 9:121131174-121131196 GAAGGTTAACAAGGATATCCAGG - Intronic
1203757995 Un_GL000218v1:153933-153955 GAAAGTTAACAAGGATATACAGG - Intergenic
1203491872 Un_GL000224v1:114521-114543 GAAGGTTAACAAGGATATCCAGG - Intergenic
1203504496 Un_KI270741v1:56392-56414 GAAGGTTAACAAGGATATCCAGG - Intergenic
1203717386 Un_KI270742v1:166609-166631 GAAAGTTAACAAGGATATACAGG - Intergenic
1203533837 Un_KI270743v1:11624-11646 GAAAGTTAACAAGGATATACAGG + Intergenic
1187248118 X:17572209-17572231 GGAGGTTAACAAGGATATCCAGG - Intronic
1187705160 X:22002990-22003012 GAAGGTTAACAAGGATATCCAGG - Intergenic
1188035826 X:25316475-25316497 GAAAGTTAACAAGGATATACAGG - Intergenic
1188109741 X:26182796-26182818 GAAGGTTAACAAGGATATCCAGG + Intergenic
1188119274 X:26284845-26284867 GAAGGTTAACAAGGATATCCAGG - Intergenic
1189017440 X:37298987-37299009 GAAGGTTAACAAGGATATCCAGG - Intergenic
1190683173 X:52847027-52847049 GAAGGTTAACAAGGATATCCAGG - Intergenic
1191042989 X:56105257-56105279 GAAGGTTAACAAGGATATCCAGG - Intergenic
1191084531 X:56549808-56549830 GAAGGTTAACAAGGATATCCAGG + Intergenic
1191122253 X:56918679-56918701 GAGGGTTAACAAGGATATCCAGG - Intergenic
1191711581 X:64154760-64154782 GAAGGTTAACAAGGATATACAGG + Intergenic
1191772513 X:64776586-64776608 GAAGGTTAACAAGGATATCCAGG - Intergenic
1192160043 X:68778281-68778303 GAAGGTTAACAAGGATATCCAGG + Intergenic
1192293814 X:69826242-69826264 GAAGGTTAACAAGGATATCCAGG - Intronic
1192294600 X:69834247-69834269 GAAGGTTAACAAGGATATCCAGG - Intronic
1192335236 X:70213942-70213964 GAAGGTTAACAAGGATATCCAGG - Intergenic
1192396136 X:70782928-70782950 GATGGTTAACAAGGATATCCAGG + Intronic
1192613157 X:72588030-72588052 GAAGGTTAACAAGGATATCCAGG + Intronic
1192628785 X:72758526-72758548 GAAGGTTAACAAGGATATCCAGG - Intergenic
1192652925 X:72962288-72962310 GAAGGTTAACAAGGATATCCAGG + Intergenic
1192663050 X:73062255-73062277 GAAAGTTAACAAGGATATACAGG + Intergenic
1192721571 X:73704006-73704028 GAAGGTTAACAAGGATATCCAGG + Intergenic
1192826165 X:74698307-74698329 GAAGGTTAACAAGGATATCCAGG + Intergenic
1192843846 X:74884744-74884766 GAGAGTTAACAAGGATATCCAGG + Intronic
1192857049 X:75023335-75023357 GGAGGTTAAAAAGGATATCCAGG - Intergenic
1192858034 X:75035168-75035190 GGAGGTTAAAAAGGATATCCAGG - Intergenic
1192896850 X:75452487-75452509 GAAGGTTAACAAGGATATACAGG + Intronic
1192973537 X:76258898-76258920 GAAGGTTAACAAGGATATCCAGG - Intergenic
1193001795 X:76570630-76570652 GAAGGTTAACAAGGATATCCAGG + Intergenic
1193123187 X:77844987-77845009 GAAGGTTAACAAGGATATCCAGG - Intronic
1193281272 X:79653945-79653967 GAAGGTTAACAAGGATATCCAGG - Intergenic
1193315823 X:80064088-80064110 GAAGGTTAACAAGGATATCCAGG - Intergenic
1193338838 X:80322028-80322050 GAAGGTTAACAAGGATATCCAGG + Intergenic
1193376647 X:80769190-80769212 GAAGGTTAACAAGGATATCCAGG + Intronic
1193402848 X:81066249-81066271 GAAGGTTAACAAGGATATCCAGG + Intergenic
1193412154 X:81177662-81177684 GAAGGTTAACAAGGATATCCAGG + Intronic
1193457225 X:81745745-81745767 GAAAGTTAACAAGGATATACAGG + Intergenic
1193461309 X:81793657-81793679 GAGAGTTAACAAGGATATCCAGG + Intergenic
1193641215 X:84011445-84011467 GAAGGTTAACAAGGATATACAGG + Intergenic
1193729082 X:85080634-85080656 GAAGGTTAACAAGGATATCCAGG - Intronic
1193806808 X:86004861-86004883 GAAGGTTAACAAGGATATCCAGG + Intronic
1194342151 X:92718181-92718203 GAAGGTTAACAAGGATATCCAGG + Intergenic
1194588706 X:95770198-95770220 GAAGGTTAACAAGGATATCCAGG + Intergenic
1194772633 X:97923648-97923670 GAAGGTTAACAAGGATATCCAGG + Intergenic
1195088672 X:101438205-101438227 GAAAGTTAACAAGGATATACAGG - Intronic
1195163088 X:102190516-102190538 GAAGGTTAACAAGGATATCCAGG - Intergenic
1195665312 X:107424290-107424312 GAAGGTTAACAAGGATATCCAGG + Intergenic
1195874282 X:109522195-109522217 GGAAGTTAACAAGGATATCCAGG + Intergenic
1196012289 X:110901932-110901954 GAAGGTTAACAAGGATATCCAGG - Intergenic
1196115629 X:111996527-111996549 GAAGGTTAACAAGGATATCCAGG - Intronic
1196167230 X:112549203-112549225 GAAGGTTAACAAGGATATCCAGG - Intergenic
1196229950 X:113210066-113210088 GAAGGTTAACAAGGATATCCAGG - Intergenic
1196600144 X:117592071-117592093 GGAAGTTAACAAGGATATTCAGG + Intergenic
1198293452 X:135261340-135261362 GAAGGTTAACAAGGATATCCAGG - Intronic
1198725582 X:139673859-139673881 GAAGGTTAACAAGGATATCCAGG - Intronic
1199933338 X:152546982-152547004 GAAGGTTAACAAGGATATCCAGG + Intergenic
1199968277 X:152838841-152838863 GAAGGTTAACAAGGATATCCAGG - Intronic
1200269503 X:154668964-154668986 GAAGGTTAACAAGGATATCCAGG - Intergenic
1200371156 X:155726362-155726384 GAAGGTTAACAAGGATATCCAGG - Intergenic
1200650509 Y:5834877-5834899 GAAGGTTAACAAGGATATCCAGG + Intergenic
1200810264 Y:7477356-7477378 GAAGGTTAACAAGGATATCCAGG - Intergenic
1201350525 Y:13035656-13035678 GAAGGTTAACAAGGATATTCAGG + Intergenic
1201353708 Y:13074332-13074354 GAAGGTTAACAAGGATATCCAGG + Intergenic
1201364513 Y:13188624-13188646 GAAGGTTAACAAGGATATGCAGG + Intergenic
1201400327 Y:13597719-13597741 GGGCATTGATTAGGATATACTGG - Intergenic
1201498563 Y:14616985-14617007 GGAGGTTAACAAGGATATCCAGG - Intronic
1201522016 Y:14886079-14886101 GGAAGTTAACGAGGATATCCAGG - Intergenic
1201670342 Y:16513441-16513463 GAGGGTTAACAAGGATATTCAGG - Intergenic
1201752018 Y:17443326-17443348 GAAGGTTAACAAGGATATCCAGG - Intergenic
1201938941 Y:19437636-19437658 GAAGGTTAACAAGGATATCCAGG + Intergenic
1202091522 Y:21195692-21195714 GAAGGTTAACAAGGATATCCAGG - Intergenic
1202241631 Y:22776830-22776852 GAAGGTTAACAAGGATATCCAGG - Intergenic
1202394614 Y:24410574-24410596 GAAGGTTAACAAGGATATCCAGG - Intergenic
1202476170 Y:25259518-25259540 GAAGGTTAACAAGGATATCCAGG + Intergenic