ID: 969918704

View in Genome Browser
Species Human (GRCh38)
Location 4:10515341-10515363
Sequence GAGAGAAATCAGGATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 783
Summary {0: 1, 1: 0, 2: 9, 3: 77, 4: 696}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969918704 Original CRISPR GAGAGAAATCAGGATGAGGA TGG (reversed) Intronic
900186767 1:1336520-1336542 GAGTGAGAACAGGATGGGGAAGG + Intronic
900921688 1:5676151-5676173 GGGAGAAACCAGGCTGAGCATGG - Intergenic
901208037 1:7508534-7508556 CAGAGAACTCAGGGTGAGCAGGG - Intronic
901277557 1:8004495-8004517 AGGAGAAAGCAGGATGACGATGG - Intronic
901435295 1:9243848-9243870 GAGAGAGATGAGGAAGAGGCGGG + Intronic
901751728 1:11414211-11414233 CAGACAAAGCAGGGTGAGGAGGG - Intergenic
902097352 1:13957666-13957688 GAGAGAAAGCAAGGTGGGGATGG + Intergenic
902105590 1:14033240-14033262 GAGAGAAACCAGGGTGGGCAAGG + Intergenic
902290509 1:15431836-15431858 CAGAGAAAGCAGGTTGAGGAGGG + Intergenic
902449354 1:16486668-16486690 GAGAGAGCACAGGATGGGGATGG + Intergenic
902468741 1:16633353-16633375 AAGAGAACACAGGATGGGGATGG + Intergenic
902677777 1:18020803-18020825 GAGAGAAAGAAGGAAGAAGAGGG - Intergenic
902886385 1:19407832-19407854 GCAAGCAATCAGGAAGAGGAGGG + Intronic
903154383 1:21434293-21434315 GAGAGAGCACAGGATGGGGATGG - Intergenic
904294820 1:29513342-29513364 TATAGAAATCAGGATGATGGGGG + Intergenic
904329576 1:29749507-29749529 CAGAGAAAGCAGGGTGAGGGAGG + Intergenic
904928623 1:34068239-34068261 GAGAATGACCAGGATGAGGAAGG - Intronic
905058298 1:35117947-35117969 GAGAGAAAATAGGCTGGGGACGG + Intergenic
905170286 1:36105974-36105996 GAGAGAGATAAGGAGGAGGCAGG + Intronic
905423490 1:37864237-37864259 ATGAGAAATGAGGTTGAGGAGGG - Intronic
905776373 1:40669910-40669932 GATAGAAGTGAGGAAGAGGAAGG - Intergenic
906091732 1:43185344-43185366 CAGAGAAATCAGGGTAAGGCGGG + Exonic
906269609 1:44465301-44465323 GAGAGGAATTAGGATTGGGAAGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906756226 1:48318304-48318326 AAGAGAAATCAAGATCAGAAAGG + Intronic
907342622 1:53747793-53747815 GAGAAAACACAGGATGAGGAGGG - Intergenic
907703223 1:56810018-56810040 GAGAGAAAGAAGGAGGAGGAAGG + Intronic
908257427 1:62314500-62314522 GGCAGAAACCAGGATGTGGAGGG + Intronic
908345556 1:63228762-63228784 GGGAGAAATCATGATGAGAGCGG - Intergenic
909897327 1:81089055-81089077 GAGATGAATCATGAAGAGGAGGG - Intergenic
909972740 1:82009730-82009752 AAGAGAAATAAAAATGAGGATGG - Intergenic
910549848 1:88463205-88463227 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
911391942 1:97256288-97256310 GAGAGAAGGAAGGATGAGGAAGG - Intronic
911422099 1:97655878-97655900 GGGAGAAATCAGGATGAAAAGGG + Intronic
911434733 1:97843100-97843122 AAGAGAAGTCAGGATGATGAAGG - Intronic
912116734 1:106416726-106416748 GAGAGAAAACAGGTTAAAGAAGG + Intergenic
912744000 1:112229834-112229856 GAGAGAAATTTGAATGAGGAGGG + Intergenic
912959074 1:114179372-114179394 GAGAGGAAGAGGGATGAGGAAGG - Intergenic
913440509 1:118892008-118892030 GAGAGAAATAAAAATGAGAATGG + Intronic
913691441 1:121283261-121283283 GAGAGAGATGAGGATGAAGAGGG + Intronic
914146104 1:144996721-144996743 GAGAGAGATGAGGATGAAGAGGG - Intronic
914746496 1:150505278-150505300 GAGAGAATTGAGGATATGGATGG + Intronic
914814965 1:151056576-151056598 GAGGGAAATCAGGAGGAATAGGG - Intronic
915822267 1:159037400-159037422 GGGAGAAACCATGATGAGTAAGG - Intronic
915897037 1:159820174-159820196 GAGAAAGATGAGGATGGGGAGGG - Intergenic
916052990 1:161049095-161049117 GAGAGGCAGCAGGATGTGGAAGG - Exonic
916084966 1:161261853-161261875 GAGAGCAAACAGGATAATGAAGG - Intronic
916156097 1:161850264-161850286 GAGAGGGAACAGGATGAGGCTGG - Intronic
916318014 1:163472098-163472120 GAGAGAAATAAGGAGCAAGAGGG - Intergenic
916493780 1:165326705-165326727 GACAGGAAACAGGATGAAGAGGG - Intronic
916655124 1:166868514-166868536 GTGGGAGATCAGGATGAAGAAGG - Intronic
917095035 1:171391404-171391426 GAGGGAAATAAGGATAAAGATGG - Intergenic
917198557 1:172492252-172492274 GGGAGAAGACAGGATGGGGATGG - Intergenic
919373503 1:196762975-196762997 GAGAGAATTCAGAGTGATGAGGG + Intergenic
919379944 1:196847652-196847674 GAGAGAATTCAGGGTGATGAGGG + Intronic
919759361 1:201087681-201087703 GAGAGAAGGGAGGAGGAGGAAGG - Intronic
920196904 1:204234111-204234133 GAGATAATCCTGGATGAGGATGG + Intronic
920233927 1:204490193-204490215 GAGAGTTCTCAGGAAGAGGAAGG + Exonic
920478767 1:206301738-206301760 GAGAGAGATGAGGATGAAGAGGG + Intronic
921674918 1:217966336-217966358 GAGAGAAGTCTGGCTGGGGATGG - Intergenic
921818349 1:219589156-219589178 GAGAGAAATGAGGCATAGGAGGG - Intergenic
922174739 1:223188735-223188757 GAGATAAAGAAGGAGGAGGAAGG + Intergenic
922601242 1:226856127-226856149 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
922824942 1:228511467-228511489 GAGGGAAAGGAAGATGAGGAAGG + Intergenic
923238519 1:232058263-232058285 GAGAGAAATCAGGATTATGAAGG - Intergenic
923559980 1:235031640-235031662 GAAAGAAATCATGAAGAAGAAGG + Intergenic
924181312 1:241441109-241441131 GAGAGAAGACAGGATGTAGAGGG - Intergenic
924325197 1:242888778-242888800 GAGAGAGATTAGGATGAGAAAGG - Intergenic
924687328 1:246307741-246307763 AAGAGAAAGCAGCACGAGGAGGG + Intronic
1063037417 10:2300226-2300248 GAGAGAAAGACGGCTGAGGAGGG - Intergenic
1063253960 10:4305869-4305891 GAAAGTAATCAGCATGAGGTGGG - Intergenic
1063624267 10:7674788-7674810 TAGAGAAATAGAGATGAGGAAGG - Intergenic
1063948728 10:11202887-11202909 GAGAGAGATGAGGATGGGGGTGG - Intronic
1064054033 10:12082330-12082352 GAAAGAAAACAGAATGAGGCGGG - Intronic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1066978840 10:42392693-42392715 GAGAGAAGGGAGGATGAGGGAGG + Intergenic
1067349378 10:45462240-45462262 GAGAAAGGTCAGAATGAGGAGGG + Intronic
1067768599 10:49108010-49108032 GGGAGAAGAGAGGATGAGGAGGG + Intronic
1068515417 10:58019894-58019916 GAGGGCAATCAGGAAGATGAGGG - Intergenic
1068936351 10:62639052-62639074 GAGAGGATCCAGGTTGAGGAGGG + Intronic
1069686819 10:70324049-70324071 GAGAGAGAACAGGATGAGGAGGG + Intronic
1069838145 10:71322292-71322314 GAAAGAAATAAGGAGCAGGATGG - Intronic
1069883622 10:71609531-71609553 CAGAGAGCTCAGGAAGAGGAAGG - Intronic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070533280 10:77356222-77356244 GAGAGAAAACAGGGTCAGAATGG - Intronic
1070647873 10:78214029-78214051 GAGAGCAAGCAGCATGAGGCTGG - Intergenic
1071011157 10:80942211-80942233 GAGAGAAGGAAGCATGAGGAGGG - Intergenic
1071028369 10:81141975-81141997 GAGAGAAAGAAGGAAGAAGATGG - Intergenic
1071049929 10:81435022-81435044 GAGAGTGAGCAGGATGAGGAGGG + Intergenic
1071203798 10:83251655-83251677 GAGAGAAAAGAGGAAGAAGAAGG + Intergenic
1071794461 10:88990504-88990526 GGGAGAAGTCAGGGTGAGGAAGG - Intronic
1072183693 10:93013659-93013681 TAGAAAAATCAGGATGATGCAGG - Intronic
1072230494 10:93410288-93410310 GTGACAAACCAGGAGGAGGAAGG - Intronic
1072425976 10:95331249-95331271 CAGGGAAATCAGGATGGGGTGGG - Intronic
1072529520 10:96305872-96305894 AAGAGAAATCAGGTGGAAGAAGG - Intronic
1072613353 10:97033815-97033837 GACAGCAATAAGGATCAGGAAGG + Intronic
1072620715 10:97077362-97077384 GAGAGCACCCAGGATTAGGAAGG - Intronic
1073327496 10:102651101-102651123 GAGTGAGAGCAGGAAGAGGAAGG - Intronic
1073337635 10:102722057-102722079 GAGAATAAACAGGATGTGGATGG - Intronic
1074039888 10:109777810-109777832 GAGAAAAATGAGGACTAGGAAGG - Intergenic
1074609998 10:115012376-115012398 AAGAGAAATCATGAAAAGGAGGG + Intergenic
1074975517 10:118577978-118578000 GAGAGCTATCAGAATGGGGAAGG + Intergenic
1074979284 10:118606738-118606760 CAGACAAATCAAGATGAGGTTGG - Intergenic
1075786058 10:125050934-125050956 GGGAGACATCTGGATGAGGAGGG + Intronic
1076293198 10:129363555-129363577 GGGAGGAATCAGGAAGGGGATGG - Intergenic
1076464435 10:130668838-130668860 GAGACTAATCAGGATAAGGAAGG + Intergenic
1076897907 10:133323142-133323164 GAGAGGAAGCAGGAGAAGGATGG - Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1078075791 11:8159184-8159206 GAGAGAAAACATGAAGACGAAGG + Intronic
1078280778 11:9898945-9898967 GAGGAAAATCAAGATGGGGAAGG + Intronic
1078950027 11:16120156-16120178 GAGAGAGAGCAGGAGGGGGAGGG - Intronic
1079260768 11:18878106-18878128 AAGAGAAATCAGATTGTGGATGG + Intergenic
1079264674 11:18919878-18919900 TAGAGAAATCAGGCTGTGGATGG + Intergenic
1079879084 11:25900930-25900952 GGGAGAAATAAGAAAGAGGATGG - Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080729791 11:34937629-34937651 GAGAGTCATCAGCATGTGGATGG + Intronic
1080874574 11:36264306-36264328 GTGAGAGATCATGATGAGGATGG + Intergenic
1082199652 11:49349837-49349859 GAGAGAAAATAGGAGGGGGAGGG - Intergenic
1082799070 11:57400857-57400879 GAGAGTAATAAGGATAAGTAAGG - Intronic
1083722145 11:64608729-64608751 GAGAGAGTTCAGGAGGAGGCAGG - Intronic
1084639283 11:70414823-70414845 GAGAGGAAGCAGGATGCGGCGGG + Intronic
1084896181 11:72271236-72271258 TACAGAAATCAGGTAGAGGAAGG + Intergenic
1085104335 11:73829269-73829291 GTGAGAAAGCAGGGTGAGGAGGG + Intronic
1085550861 11:77369914-77369936 GAGAGGAACCAAGATAAGGAAGG - Intronic
1085753964 11:79188653-79188675 AAGAGAAGTGAGGATGGGGATGG + Intronic
1086656015 11:89356393-89356415 GAGAGAAAATAGGAGGGGGAGGG + Intronic
1086947798 11:92860466-92860488 GAGAGAAGGCAGGAGAAGGAGGG + Intronic
1087092161 11:94284695-94284717 GGGAGACTTCAGAATGAGGAAGG + Intergenic
1087792367 11:102420140-102420162 GAGAGCAGGCTGGATGAGGATGG - Intronic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1088238343 11:107749034-107749056 GAGGGAAATTAGGAGGATGAAGG + Intergenic
1088789383 11:113211053-113211075 GAGAGAAAGGAGGATGAGAAGGG - Intronic
1089011575 11:115136146-115136168 GAGAAAGTTCAGGAAGAGGAAGG - Intergenic
1089360852 11:117885559-117885581 GAGAGGGATCAGAATGGGGATGG + Intergenic
1089362318 11:117899181-117899203 GAGAAAAAGCAGGATCTGGATGG - Intergenic
1089380906 11:118030752-118030774 GAGCCAAAGCAGGATGAGGAGGG + Intergenic
1089382369 11:118044459-118044481 GAGAGAAATCATGATTTAGATGG - Intergenic
1089772385 11:120813024-120813046 GAAAGAGAACAGGATGAGAATGG + Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090132533 11:124159705-124159727 GAGGGAAATGAAGAGGAGGAGGG - Intergenic
1090725606 11:129524189-129524211 GAGAGAAAACAGAATTAGAATGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090960093 11:131548603-131548625 GAAAGAAGTCAGGATGGGGAAGG - Intronic
1091231490 11:133990815-133990837 GAGAGACAACAGGGAGAGGAAGG - Intergenic
1091653415 12:2326152-2326174 GAGAAAAAGGAGGATGACGAGGG + Intronic
1091794020 12:3287119-3287141 GAACAAAATCAGGATGAGGATGG + Intergenic
1091832292 12:3558190-3558212 GAGACAGAGCAGGATGATGAGGG - Intronic
1092071668 12:5636554-5636576 GAGAGAAAACAGCAGGTGGAAGG + Intronic
1092302693 12:7267281-7267303 CACAGAAGCCAGGATGAGGATGG - Intergenic
1092395428 12:8121789-8121811 GAGTGCAAGCAGGGTGAGGAGGG + Intergenic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1092733110 12:11553088-11553110 GAGAGGAGTCAGGATTACGAAGG + Intergenic
1092997377 12:13963010-13963032 GAGAGAATAAAGGAAGAGGAAGG - Intronic
1093091109 12:14921348-14921370 CAGATAAATGAGGATGAGGAAGG + Intronic
1094260362 12:28490156-28490178 AAGAGTAATTAGGATGAGAAAGG - Intronic
1094350573 12:29520407-29520429 TAGAGAAATGAGTATGAGAATGG + Intronic
1095516053 12:43006755-43006777 GAGAGAAATAAGGATGACAAGGG - Intergenic
1096081693 12:48837579-48837601 AATGGAAATGAGGATGAGGAAGG - Exonic
1096169691 12:49457727-49457749 TAAAGAAAACAGGATGAGGCCGG - Intronic
1096665165 12:53159715-53159737 GAGAGGAATGAGAAAGAGGAAGG + Intronic
1096820528 12:54230313-54230335 GAGAGAAGTGAGGAAGATGAAGG - Intergenic
1096977796 12:55709297-55709319 GACAGAACACAGGAAGAGGAAGG - Intronic
1096983467 12:55742493-55742515 GAGAGAAATCAGGATGGGGGAGG - Intergenic
1097170365 12:57109595-57109617 GAGAGAACTAAGGAAGAGGATGG + Intronic
1097710914 12:62915899-62915921 GGGAGACAGCAGCATGAGGAAGG - Intronic
1097981780 12:65742645-65742667 AAGGGAAATCCGGATAAGGATGG + Intergenic
1098006915 12:66007356-66007378 TATAGAAAGCAGGATGAAGAGGG - Intergenic
1098034067 12:66284211-66284233 AAGAGAACTCAGGCTGTGGATGG + Intergenic
1098037375 12:66318009-66318031 GAATGAAAGAAGGATGAGGAAGG + Intronic
1098085065 12:66833570-66833592 GAGTGAACTCAGGATGCTGAGGG - Intergenic
1098293408 12:68980449-68980471 TGAAGAAATCAGGATGGGGAAGG - Intergenic
1098408921 12:70158226-70158248 AAGAGAAACTAGGGTGAGGAAGG - Intergenic
1098416558 12:70241931-70241953 AGGAGAAAGCAGGAAGAGGAAGG + Intergenic
1098857103 12:75665384-75665406 GATAGCAATCAAGATGAGAAAGG - Intergenic
1099133173 12:78862193-78862215 GAGAGAATTTAGGAATAGGAGGG + Intergenic
1100157179 12:91813805-91813827 CAAAGAAATGAAGATGAGGAAGG + Intergenic
1100210841 12:92397039-92397061 GAGAGACACCAGGCTCAGGATGG - Intergenic
1100213316 12:92420974-92420996 GAGAGAGATCAGGAGAAAGATGG - Intronic
1100365322 12:93915176-93915198 GAGAGGGCTCAGGATGAGGAAGG + Intergenic
1100447505 12:94675200-94675222 GAGAGAAAGCAAGATGGGAAGGG - Intergenic
1101124643 12:101619309-101619331 AAGAGAAATCAGGAGAAAGAAGG - Intronic
1101245271 12:102878673-102878695 GGGAGAAAACAAGATAAGGAAGG + Intronic
1102214050 12:111147645-111147667 GAGAGGAGACAGGATGAAGATGG + Intronic
1102871173 12:116414957-116414979 GAGAGAAATTCGGATGAACAGGG + Intergenic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103186072 12:118958633-118958655 GAGAGAAAATGGGATGGGGATGG - Intergenic
1103518599 12:121523291-121523313 GAGAGAAATAAGGACAAGGGCGG + Intronic
1104023873 12:125012184-125012206 TAGAGAAATCAGGCAGAGGAAGG + Intronic
1104026604 12:125032110-125032132 GAAGGAAACCAGAATGAGGAGGG + Intergenic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104554454 12:129787124-129787146 GATAGAAATTATAATGAGGAGGG - Intronic
1105269088 13:18854175-18854197 AAGAGAAAGAAAGATGAGGAGGG - Intergenic
1105595846 13:21837246-21837268 GACAGAAATTCGGAAGAGGATGG - Intergenic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1106250946 13:27981084-27981106 GTGAGGAATCAGGTAGAGGATGG + Intronic
1106402374 13:29442782-29442804 GAGAGACTTGAGCATGAGGAAGG + Intronic
1107408679 13:40138771-40138793 GAGAGGAGTCAGGGTGAGCAGGG + Intergenic
1107424043 13:40275364-40275386 GTGAGAAGTCAGGGTGGGGATGG - Intergenic
1107851204 13:44575468-44575490 GAGGCAAATGAGGCTGAGGAAGG + Exonic
1108232950 13:48369595-48369617 GAAAGAAAACAAGATGAGGTTGG - Intronic
1108813334 13:54258231-54258253 GAGAGAAAGAAGGAAGTGGAAGG - Intergenic
1108853318 13:54762562-54762584 AAGAAAAATGAGGAAGAGGAGGG + Intergenic
1109224670 13:59678424-59678446 AATAGAAATAAGGATGAGTAGGG - Intronic
1109958134 13:69595354-69595376 GAGGGAGAGCAGGGTGAGGAGGG + Intergenic
1110441248 13:75528515-75528537 TAAAGAAATCAGGCTGAGCATGG + Intronic
1111132935 13:83999747-83999769 GAGAGAAATGAGGAGGAGAAAGG - Intergenic
1111233275 13:85372761-85372783 GAGAGGAAACAAGAGGAGGAGGG - Intergenic
1111777396 13:92681668-92681690 GAGAGAAATGAGAATTAGGAGGG - Intronic
1112103602 13:96216948-96216970 GAGGGAAATCAGGAATCGGAAGG - Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114607717 14:24011339-24011361 AAGAGAAATCAGAAAGAGAAAGG - Intergenic
1114968720 14:27999585-27999607 GACAGAAATCGGGAACAGGATGG - Intergenic
1115003889 14:28456336-28456358 GACAGAAATCTGGCTGACGATGG + Intergenic
1115067465 14:29282057-29282079 GAGAGAAGACAGGTTGAAGAGGG - Intergenic
1115492144 14:33967887-33967909 AAGAGAAGTCAGGAAGGGGAAGG + Intronic
1115692689 14:35861113-35861135 AAGAGAAATAAGAATGAGAATGG + Intronic
1116464926 14:45220735-45220757 GACAGAAATCAGGGAGAGGGAGG + Intronic
1116570016 14:46504273-46504295 GAGAGAAATCAGCATGTTCATGG - Intergenic
1116628404 14:47297387-47297409 GAGAGAAAGAAGAAAGAGGAAGG + Intronic
1116663541 14:47744874-47744896 GAGAGGAATGAGGATCAGAAAGG + Intergenic
1116735490 14:48685538-48685560 AAGAGAAATCAGCCTGGGGAAGG + Intergenic
1116955890 14:50922825-50922847 GAGAGGGAGCAGGATGAGGTGGG - Intronic
1117179848 14:53180880-53180902 GTGAGAAATCCCCATGAGGAGGG - Intergenic
1117553334 14:56858110-56858132 GAGAGAAAGAAGGAGGAGGAGGG + Intergenic
1117601944 14:57385259-57385281 GAAGGAAATCAGCATTAGGATGG + Intergenic
1117737170 14:58779698-58779720 GAGAGAAATCAGGATGGACTAGG - Intergenic
1118463093 14:66004356-66004378 GAGAGAAAGGAGGGAGAGGAAGG - Intronic
1118631396 14:67706933-67706955 CAGAGAAATTAGGGGGAGGAAGG + Intronic
1118839970 14:69502621-69502643 AAGAAAAAGCAGGATGATGATGG + Intronic
1118933281 14:70263029-70263051 GAGGGATCTCAGGGTGAGGATGG + Intergenic
1118981835 14:70723379-70723401 GAGAGGAAACAGGGCGAGGAAGG + Intronic
1119426583 14:74539347-74539369 GAGAGAGATCAGGAAGAGCTGGG + Intronic
1119449433 14:74695881-74695903 TAGAGCAATCAGTATGAGAAGGG + Intronic
1119934339 14:78577086-78577108 AGAAGAAATCAGGATGAAGAAGG - Intronic
1120284442 14:82480485-82480507 GAGAGAAAGCAAGAAGGGGAGGG - Intergenic
1120532988 14:85656760-85656782 AAGAGAAATGAGGATTTGGAAGG - Intergenic
1120550562 14:85866888-85866910 GAAAGAAATCATGATGAGGGAGG + Intergenic
1120648932 14:87107591-87107613 GAGAGAGATATGGATGGGGAAGG - Intergenic
1120897629 14:89547990-89548012 GAGAGAAAGTAGGAGGTGGAAGG + Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121941430 14:98074574-98074596 GTGAGAAAGGAGGGTGAGGAAGG - Intergenic
1121962134 14:98270941-98270963 AATAGAAATCAGGATGATCAAGG + Intergenic
1122005025 14:98696119-98696141 GAGAAAAATGGTGATGAGGAAGG + Intergenic
1122569425 14:102684498-102684520 GCGAGAAGGCAGGATGAGGACGG + Intronic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123614994 15:22137541-22137563 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123811632 15:23932531-23932553 GTGAGAAAGCAGGAGCAGGAAGG + Intergenic
1123874449 15:24609648-24609670 GTGAGAAGTCAGGAGCAGGAAGG + Intergenic
1123947868 15:25247636-25247658 GGGAGAAAGCAGGCTCAGGAAGG - Intergenic
1124027539 15:25980668-25980690 GAGTGAGATCAGGGTGAGCATGG + Intergenic
1124152724 15:27196326-27196348 GAGAGAGAGCAGGAACAGGAGGG - Intronic
1124387264 15:29220282-29220304 CAGAGAAACCAGGATCAGAAAGG + Intronic
1124503677 15:30253170-30253192 GAGAGAAAACAGGATGCAGGAGG - Intergenic
1124739879 15:32285468-32285490 GAGAGAAAACAGGATGCAGGAGG + Intergenic
1124972576 15:34503218-34503240 GAGAGAAATGAGAATTAGGAGGG - Intergenic
1125039489 15:35167785-35167807 GAAAGATATCAGGAAGAGAAAGG - Intergenic
1125271074 15:37939380-37939402 GAGAGAAATCAGGAAGAAATTGG + Intronic
1125431532 15:39599527-39599549 GAGAGAAAGAAGGAGGAGGGAGG - Intergenic
1125762013 15:42103258-42103280 GAGAGAAATGAATAGGAGGAAGG - Intergenic
1126244295 15:46486139-46486161 GAGAGGAAGCAGGATGTGCAAGG - Intergenic
1126411111 15:48374104-48374126 GGGAGAAATGGGGAGGAGGAGGG - Intergenic
1126540051 15:49812544-49812566 GAGAAAAAGAAGGAAGAGGAGGG - Intergenic
1126782374 15:52149786-52149808 GAGAGAAATCAGGACAGGGCCGG + Intronic
1127314770 15:57784505-57784527 GTGAGAATTCAGTATGAGAAGGG - Intergenic
1127402372 15:58602334-58602356 GAGTGCAAGTAGGATGAGGAAGG - Intronic
1128113999 15:65094252-65094274 GAGGGAGATCAGGAAGAGGTGGG - Intronic
1128614194 15:69096572-69096594 GAGAGAGGTTAGGAGGAGGAGGG + Intergenic
1128723525 15:69970930-69970952 GATAGGAATGGGGATGAGGATGG - Intergenic
1129338110 15:74866158-74866180 AAGTGAAAACAGGCTGAGGAAGG + Intronic
1129491139 15:75926723-75926745 GAGAGAAGGAAGGATGGGGAAGG + Intronic
1129705378 15:77791230-77791252 GAGGGACAAGAGGATGAGGAGGG + Intronic
1130231881 15:82103411-82103433 TAGAGAAAGCAGGCAGAGGATGG + Intergenic
1130238946 15:82167265-82167287 GAGAAAAATCAGGATCATAAAGG - Intronic
1130407724 15:83617241-83617263 GAGAGAAACCAGGACAAGAAAGG - Intronic
1130867874 15:87947701-87947723 AAGAGAAAACAGGGAGAGGAAGG + Intronic
1130918915 15:88327733-88327755 GAGAGTGATCAGGATGGTGAAGG - Intergenic
1131418722 15:92285117-92285139 GAGAGAAATAATGATGAGGCAGG - Intergenic
1131613167 15:93986348-93986370 AAGAGAGATTAGGATGAAGAGGG - Intergenic
1202987239 15_KI270727v1_random:429304-429326 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1132989942 16:2787290-2787312 GAGAGGAGTGAGGATGAGGGAGG - Intronic
1134186759 16:12090609-12090631 GAGAGAAACCAGGATGGAAATGG - Intronic
1134206398 16:12241824-12241846 GAGAGAAAACAGTCTGATGATGG - Intronic
1134249635 16:12565445-12565467 GAGAGAACCCAGGATGAGGAGGG - Intronic
1134434528 16:14243814-14243836 GATAGAAGTCAGGATGATCATGG - Intronic
1137019997 16:35415133-35415155 CAGAAAATTCAGGATGGGGAAGG - Intergenic
1137243889 16:46687298-46687320 GAGAGAAATAAGGATGATGAGGG + Intronic
1137528798 16:49262953-49262975 GAAAGAGGTCAGGATGAGGCTGG - Intergenic
1137798462 16:51241257-51241279 AAGAGAAATAGGGAGGAGGAGGG + Intergenic
1138065331 16:53935160-53935182 GAGAGGAATCAGGAAGCGTATGG + Intronic
1138215915 16:55205174-55205196 GAGAGAAGTCAGCAGGAGGTTGG - Intergenic
1138217239 16:55214833-55214855 GGGAGGAATGAGGAAGAGGAAGG + Intergenic
1138349798 16:56340435-56340457 TAGAGAAATCTGCATGAGCAGGG + Intronic
1138434100 16:56987609-56987631 GAGAGAACTCAGGAGGTGGGTGG - Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139605158 16:68013028-68013050 GAGAGAAAAGAGGAAGAAGAAGG + Intronic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1141157750 16:81609210-81609232 GAGAGAAAGAAAGAAGAGGAAGG - Intronic
1141309543 16:82900018-82900040 GAGAGCAATCAAGATGGGGCAGG - Intronic
1143309926 17:5979617-5979639 GAGGGAAACCAAGATGAGAAAGG + Intronic
1144047321 17:11465671-11465693 GAGTGAGATCAGGCAGAGGAGGG - Intronic
1144126806 17:12210497-12210519 GAGAGGAAGAAGGAAGAGGAAGG - Intergenic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144853457 17:18255612-18255634 CAGAGAAATCAGAATCTGGATGG + Intronic
1146032367 17:29377167-29377189 AAGAGAAAGAAGGATCAGGAAGG - Intergenic
1146742431 17:35298358-35298380 GAGAGAGAAGAGGATGAGGGAGG - Intergenic
1147296422 17:39486554-39486576 AAGAAAAATCAGGCTGAGCATGG - Intronic
1148180723 17:45602647-45602669 GAGAGAAAGAAGGAAGGGGAGGG - Intergenic
1148253849 17:46110783-46110805 GAGAGAAATAAGGTTGGGGTGGG + Intronic
1148268180 17:46243279-46243301 GAGAGAAAGAAGGAAGGGGAGGG + Intergenic
1148877687 17:50700571-50700593 GAGAGAAATCAGGAAGATTATGG - Exonic
1149170276 17:53801384-53801406 GAGAGAAAGGGGGAGGAGGAAGG + Intergenic
1151108007 17:71640642-71640664 GAGAGAGAACAGGAATAGGAGGG - Intergenic
1151352122 17:73537920-73537942 GAAAGAAAAGAGGATGAAGAGGG + Intronic
1151680959 17:75622480-75622502 GGGAGAACGGAGGATGAGGATGG + Intergenic
1152097405 17:78280000-78280022 GTGACAAGTCAGGATGAGCAAGG + Intergenic
1152336879 17:79703703-79703725 GAGAGGGGTCAGGAGGAGGAAGG + Intergenic
1152493063 17:80650812-80650834 GAGATAAGGCAGGATGGGGAGGG - Intronic
1152671272 17:81608619-81608641 GAGAGAAGTAAAGATGAGAAGGG - Intronic
1153427421 18:4981547-4981569 GAGAAAAAACAGGATGGGGCTGG + Intergenic
1153726233 18:7958389-7958411 GAGAGCAATCAGGATAGGAAAGG + Intronic
1153753127 18:8253899-8253921 GAAAAAAAACAGGATGGGGAGGG - Intronic
1153941947 18:9986356-9986378 GGGAGAAATCAGGCTGTGCAGGG + Intergenic
1155015140 18:21829576-21829598 GAGAAAAACCAGGATGAGTGTGG + Intronic
1155053916 18:22169356-22169378 GAGAGAAAAGAGGGTGGGGAGGG - Intergenic
1156044548 18:32862677-32862699 GAAAGAAATCAGTATGGGGGAGG - Intergenic
1157040795 18:44036622-44036644 GACAGAAAGCAGGATGGGGGGGG - Intergenic
1157436232 18:47671802-47671824 GAGGGCACTCAGAATGAGGATGG + Intergenic
1157947141 18:51992952-51992974 GATAGAAATCAGGATGGAGAAGG - Intergenic
1158694527 18:59691835-59691857 GAGAGAAATCAGAATGGGCCTGG + Intronic
1158863958 18:61619534-61619556 GAGAGAAGGGAGGATGAGGGAGG - Intergenic
1158946528 18:62451670-62451692 GAAAGAAATCAGGCTGGGGTGGG + Intergenic
1159917196 18:74198183-74198205 GAGAGCAATCAGGTTGTGGGTGG + Intergenic
1160607813 18:80065744-80065766 GACAAAGAACAGGATGAGGAGGG - Intronic
1161030716 19:2056662-2056684 GAGAGGAGGAAGGATGAGGAGGG - Intergenic
1162180156 19:8863224-8863246 CAGAGAAATCAGGTAGAAGAGGG + Intronic
1162778149 19:12992392-12992414 GAAAGAAAGAAGGAAGAGGAGGG - Intergenic
1163775619 19:19215586-19215608 GTGTGAAGTCAGGAGGAGGATGG + Intronic
1164609839 19:29624420-29624442 GACAGAAATAAGGAGGAAGATGG + Intergenic
1164937051 19:32223225-32223247 GAGAGAAAAGAGGGGGAGGAAGG + Intergenic
1165289839 19:34874249-34874271 CAGACAGATTAGGATGAGGACGG - Intergenic
1165298549 19:34949920-34949942 GAGAGAAACAAGGAGGAAGAGGG + Intergenic
1165348361 19:35262815-35262837 GGGAGAAAGTAGGCTGAGGAGGG + Intronic
1165706303 19:37978601-37978623 GAGAGAAAACAGGCTGTGCATGG - Intronic
1165792446 19:38500293-38500315 GAGAGGACTCAGGATGGGGATGG + Intronic
1165792458 19:38500326-38500348 GAGAGGGGTCAGGATGGGGATGG + Intronic
1165792481 19:38500392-38500414 GAGAGGGGTCAGGATGAGGTTGG + Intronic
1166090068 19:40503053-40503075 GTGATAAATGAGGATGGGGATGG + Intronic
1166159578 19:40941724-40941746 GAGAGAAGACTGGCTGAGGAAGG + Intergenic
1166168519 19:41009655-41009677 GAGAGAAGACTGGCTGAGGAAGG + Intronic
1166178685 19:41091951-41091973 GAGGGAAATCAGGATGGGAGTGG + Intronic
1166881583 19:45933627-45933649 GAAAGAATTTAGGATGAGGGTGG + Intergenic
1167009393 19:46796728-46796750 GAGAGAGACCAGGAAGAGGCTGG + Intergenic
1167777146 19:51565709-51565731 GGGAGGAGGCAGGATGAGGAAGG - Intergenic
1168302682 19:55415316-55415338 GAGAGAAGTGTGGATGTGGAGGG - Intergenic
925131908 2:1499741-1499763 GAGAGAAGACAGGATGAGTTAGG - Intronic
925383747 2:3447464-3447486 GAGAGAGAAGAGGAGGAGGAGGG + Intronic
925469409 2:4142823-4142845 GAGAGGAAGCAGGCTGAGGCCGG - Intergenic
925551522 2:5080833-5080855 TTCAGAAATCAGGATGAGAAAGG - Intergenic
926301225 2:11604472-11604494 GAGAGAAGAGAGGATGATGATGG - Intronic
926531556 2:14052919-14052941 GACAGATATCATGGTGAGGAGGG - Intergenic
926772456 2:16390672-16390694 TTTAGAAATCAGGAAGAGGATGG + Intergenic
926867279 2:17373651-17373673 GAGAGAAAAAAAGAGGAGGATGG - Intergenic
927821257 2:26267282-26267304 GAGAAAAGACAGGATGAGCAAGG + Intronic
927882843 2:26700766-26700788 GAGAGATATGATGATGATGATGG - Intronic
927924431 2:27000623-27000645 GAGAGACAGGAGGAGGAGGAGGG + Intronic
928077017 2:28274155-28274177 GAGAGAAAGCTGGATGGGGAAGG - Intronic
929133041 2:38597186-38597208 GAGGGAAATGTGGATGAGGTAGG - Intronic
929649978 2:43668968-43668990 GAGAGAACTCTGGATGATCAAGG + Intronic
929828540 2:45329274-45329296 GAGAGCAATGAGGATGGGAATGG - Intergenic
929957251 2:46467529-46467551 TGGAGAAATCAGACTGAGGAGGG - Intronic
930681450 2:54260855-54260877 GAGAGAAGTGAGAATGAGGCAGG + Intronic
930777112 2:55184067-55184089 GAGAGAAAACAGGCCGAGCATGG - Intronic
930844373 2:55885891-55885913 GAGAGAAAGCAGCATGAGTCAGG - Intronic
931782291 2:65589136-65589158 GAGAGAAATGAGGATGATGATGG + Intergenic
934594696 2:95595101-95595123 CAGAGAAATCTATATGAGGAGGG + Exonic
934679779 2:96275168-96275190 GGCAGAAATCAAGATGAGCATGG + Intronic
934844738 2:97655583-97655605 CAGACAAGTCAGGATGGGGAAGG - Intergenic
935230144 2:101088860-101088882 GAAAGAAATCAGGCTGGGAATGG - Intronic
935717756 2:105953726-105953748 GAGAGAAATAAGGAAAAGTAGGG + Intergenic
936090179 2:109496779-109496801 AAGAGAAATCAGGTTGCAGATGG + Intronic
936406774 2:112211971-112211993 AAGAGAAATTAAGATGGGGAGGG - Exonic
937120497 2:119437250-119437272 GAAAGACACCAGGAGGAGGATGG - Exonic
937841772 2:126531811-126531833 GAGAAAAGTCTGGATGTGGATGG - Intergenic
938155903 2:128939764-128939786 GTGAGTAATCAGGATCAGGCAGG - Intergenic
938667921 2:133558329-133558351 GAGATAAATGAAGATGAGGAGGG + Intronic
938851504 2:135265628-135265650 GAAAAAATTCAGGCTGAGGAAGG - Exonic
939259623 2:139790362-139790384 GAAAGAAATCAGCATGAAGGAGG + Intergenic
939637396 2:144599024-144599046 GGAAGTAATGAGGATGAGGAGGG + Intergenic
939767355 2:146267376-146267398 TGGTGAAAGCAGGATGAGGAAGG + Intergenic
940433550 2:153623266-153623288 GAGGGAAAGCACGTTGAGGAAGG - Intergenic
941633255 2:167907612-167907634 GAAAGAAATGAAGAAGAGGAAGG + Intergenic
942054118 2:172166661-172166683 GTAAGAAATCAGGCTGAGCATGG - Intergenic
942208596 2:173648226-173648248 CAGAGAAAGCAGGACGGGGAGGG + Intergenic
942602681 2:177657672-177657694 GAGAGAAAGCAGAAAGAGGCGGG + Intronic
943018452 2:182543971-182543993 GACAGAATTCAGGATGTGGAGGG - Intergenic
943110597 2:183600078-183600100 GAGAGTAATCAGCATCAGGTAGG + Intergenic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
944225328 2:197343780-197343802 GAGAGAGAGCAGGATGAGGCAGG + Intergenic
944285193 2:197941737-197941759 GAGAGAAAGCAGAATGGTGAGGG - Intronic
945070630 2:205985646-205985668 GGGAGAAATCAAGATGACTACGG + Intergenic
946219125 2:218211351-218211373 GAGAGGGATCAGGACCAGGAAGG + Intergenic
946469523 2:219945530-219945552 GAGAGAAAAAAGGATGAGATGGG - Intergenic
946592050 2:221261225-221261247 GAGAGAAATGAGATTTAGGAGGG + Intergenic
946699458 2:222397163-222397185 GAGAGGAAGAATGATGAGGAGGG - Intergenic
947012532 2:225582391-225582413 GTGAGAAAGCAGGTTGGGGAAGG - Exonic
947394371 2:229672589-229672611 GAGAGGAAAAAGGATGAGGGAGG + Intronic
947400324 2:229725178-229725200 GAGAGAAAGAAGGGAGAGGAAGG + Intergenic
947531947 2:230914890-230914912 GAGAGAGAGCAGGAGGAGGTGGG + Intronic
948017695 2:234703274-234703296 GAGAGAAAGGAGGAAGAGCAGGG + Intergenic
948570874 2:238916452-238916474 GAAAGAAAGAAGGAGGAGGAAGG + Intergenic
1168864973 20:1078528-1078550 GCTGAAAATCAGGATGAGGAGGG + Intergenic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1169707263 20:8519493-8519515 GAGAGCAGGCAGGATGAAGAGGG - Intronic
1169892503 20:10468715-10468737 GAGAGAAATCAATATGGGAAAGG - Intronic
1169978468 20:11357040-11357062 GAGAAAAATCAGGGTGAGTCAGG - Intergenic
1170089891 20:12579300-12579322 TAGAAAAATCAGGATGAGGAAGG - Intergenic
1170302847 20:14905460-14905482 GTGAGAAATAAGAGTGAGGAAGG + Intronic
1170480992 20:16764665-16764687 GAGAGAAAGAAAGATGAAGAGGG - Intronic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171774538 20:29352986-29353008 GAGAGAAAGAAGGTAGAGGAAGG - Intergenic
1172393931 20:34585699-34585721 TAGAGAGATCAGGATGGGAAGGG + Intronic
1172572946 20:35984524-35984546 GAGAGAATTCAGGGGGAAGATGG + Intronic
1173017941 20:39243876-39243898 GAGAAATATCTGGATGTGGAAGG + Intergenic
1174261249 20:49297011-49297033 GGGAGAAATCAGGCTGAGAGAGG - Intergenic
1174317995 20:49717628-49717650 GAGAAAAATCAAGCTGAGGAAGG - Intergenic
1174710733 20:52702297-52702319 GAGAGAGATATGTATGAGGAAGG + Intergenic
1175052187 20:56166114-56166136 GGGAGATATCAGGAAGAAGATGG + Intergenic
1175366425 20:58459511-58459533 GATAGGGATCAGGAGGAGGAAGG + Exonic
1175657805 20:60787023-60787045 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
1176291539 21:5047971-5047993 GACATAAATCAGAATGTGGAAGG - Intergenic
1176723315 21:10410784-10410806 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1177170390 21:17648747-17648769 GAGAGAAAGCAATATGAAGATGG - Intergenic
1177796571 21:25784881-25784903 GAGAGAAAGAAGGAAAAGGAAGG - Intergenic
1178005032 21:28209042-28209064 GAGAAAAATCAAGTTCAGGAAGG - Intergenic
1178226242 21:30722214-30722236 TAGAGAAATCTTCATGAGGATGG - Intergenic
1178375952 21:32067658-32067680 GAGAGAAATCAGGATCAGGGAGG + Intergenic
1178665209 21:34540652-34540674 TAGAGATATAAAGATGAGGAAGG + Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178982134 21:37273547-37273569 GAGAAAGAGGAGGATGAGGAGGG + Intergenic
1178982152 21:37273592-37273614 GGGAGAAAGTAGGATGGGGAGGG + Intergenic
1179865716 21:44215670-44215692 GACATAAATCAGAATGTGGAAGG + Intergenic
1180124817 21:45783589-45783611 GTGAGAAGTTAGGGTGAGGACGG + Intronic
1180304473 22:11063521-11063543 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1180732159 22:17990207-17990229 GGGAGCAAGCGGGATGAGGAGGG + Intronic
1181304351 22:21906327-21906349 GAGAGAAATGTGGAGGAAGAGGG + Intergenic
1181346073 22:22221513-22221535 GGGAGCAATGAGGACGAGGAAGG - Intergenic
1181411616 22:22726105-22726127 AAGAGAAGGAAGGATGAGGAAGG + Intergenic
1181953117 22:26569157-26569179 GAAAGAATTCAGGGTGAGGCTGG - Intronic
1183206054 22:36419728-36419750 GAAAGAAATCAGGCTGGGCACGG - Intergenic
1183690817 22:39387431-39387453 GAGAGAGAGGAGAATGAGGAAGG + Intergenic
1184014616 22:41776583-41776605 GTGAGAAATCTGGAGGAGGATGG + Intronic
1184044478 22:41964213-41964235 GAGAGCTGTCAGGATGGGGAAGG + Intergenic
1184291800 22:43501371-43501393 GAGAGAAAGAAGGAAGAGGGAGG - Intronic
1185377561 22:50489200-50489222 GTGAGATACCAGGGTGAGGAGGG - Intronic
949101955 3:156247-156269 GAGAGGACTCAGGATAAAGAAGG - Intergenic
949251103 3:1984947-1984969 GAGAAGAATCCGGATGTGGAGGG - Intergenic
949259688 3:2091143-2091165 GAAAGCAATTAGGAAGAGGATGG - Intergenic
949453922 3:4218043-4218065 GAGAGAAACAAGAATGAGGAGGG + Intronic
949459437 3:4274326-4274348 GGGAGAAGTGAGGATGGGGAGGG + Intronic
949515503 3:4803562-4803584 GAGAGAGATCAGTGTGGGGAGGG + Intronic
949628125 3:5891088-5891110 CAGAGGAATTAGGATGAAGATGG - Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
952461945 3:33536719-33536741 GAGAGAAATGATGAAGATGATGG + Intronic
953258921 3:41318660-41318682 GAGGGAAATCCTGATGAGCAGGG + Intronic
953862010 3:46552572-46552594 GAAAGAAGGCAGGAGGAGGATGG - Intronic
955266886 3:57452718-57452740 AAGAGAATTCAGGATTAGAAAGG + Intronic
956216513 3:66855130-66855152 GGGAGAAATTAGGGTGAGGAGGG - Intergenic
957166246 3:76677280-76677302 GAGAAGAAAAAGGATGAGGAGGG + Intronic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
957956155 3:87190056-87190078 TAAAGAAATCAACATGAGGAGGG - Intergenic
957959167 3:87227393-87227415 GAGAGACAGCAGGAGGAGGTCGG - Exonic
958265877 3:91436276-91436298 GAGAGAAATTAGGCTGAGAGGGG - Intergenic
958720349 3:97836218-97836240 GAGAAAAATCAGGAGGAGAGAGG - Intronic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
958953629 3:100442938-100442960 AAGAGAAAATAGGAGGAGGAAGG + Intronic
959013378 3:101105159-101105181 GAGAGAATAGAGGAAGAGGATGG - Intergenic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
959820640 3:110730812-110730834 GAAAGAAACAAGGAGGAGGAAGG + Intergenic
959829223 3:110840420-110840442 GACAAAAATCAGGTTGAGAAAGG - Intergenic
960243295 3:115371142-115371164 GAGAGAAAGGAGAATGTGGAAGG - Intergenic
960680633 3:120243906-120243928 GAGGGAAAGGGGGATGAGGAAGG - Intronic
960951418 3:123000922-123000944 GCGAGAAATAAGGATGAAGTGGG + Intronic
961116291 3:124332882-124332904 GAGAGAGATGATGATGATGATGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961573026 3:127813944-127813966 GGGAAAAATAAGGAGGAGGAAGG - Intronic
962876997 3:139542731-139542753 CAGAGAGATGAGGAGGAGGAAGG + Intergenic
963084006 3:141420084-141420106 GGGAGGAGTCAGGATGAGGAAGG + Intronic
963272683 3:143301379-143301401 CAGAGAAATCAGCAAGAGGGCGG + Intronic
963297732 3:143564996-143565018 GAAAGAAACCAGGGTAAGGAGGG - Intronic
964528600 3:157643164-157643186 GAGAGAAATCTGCTTGATGAGGG + Intronic
965272096 3:166630168-166630190 GAGAGAGATGAAGGTGAGGAGGG - Intergenic
965435283 3:168643099-168643121 GAAAGAAATTAGGATTAGAAAGG + Intergenic
965553313 3:169992809-169992831 GAGAAAAAGGAAGATGAGGAGGG + Exonic
965556674 3:170025640-170025662 ATGAGAACTGAGGATGAGGAAGG + Intergenic
965669628 3:171133789-171133811 CAGAGAAATCCGGATGGAGAAGG + Intronic
965764526 3:172115937-172115959 AACAGAAATCAGAAGGAGGAGGG - Intronic
966489082 3:180506245-180506267 GAAAAAAATGAGGAAGAGGAAGG - Intergenic
967351914 3:188523321-188523343 GAGAGAAATCAGGCCCAGGAAGG + Intronic
968614907 4:1573392-1573414 GAGAGAAACCAGGAAGAGGGAGG - Intergenic
969500989 4:7552812-7552834 GGGAGGAATCAGGGTGTGGAGGG + Intronic
969727780 4:8934091-8934113 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
969918704 4:10515341-10515363 GAGAGAAATCAGGATGAGGATGG - Intronic
970555926 4:17232374-17232396 GAGATAAATGAGTATGAGGTAGG - Intergenic
970802572 4:19991488-19991510 GAGACTAAGGAGGATGAGGAGGG - Intergenic
972276131 4:37559737-37559759 GAGAGAAATAAAGAGAAGGAAGG - Intronic
972342674 4:38166042-38166064 GACAGATACCAGGCTGAGGAAGG - Intergenic
972648390 4:40991963-40991985 GAGAGAGATGGGGAGGAGGAGGG - Intronic
972712061 4:41607148-41607170 TAGAGAAATGAGGAAGAGTAAGG - Intronic
972770056 4:42189417-42189439 CAGAGAAAAGAGGATAAGGAGGG - Intergenic
972875939 4:43360110-43360132 GAGAGACATCAGGAAAAGAAAGG + Intergenic
973245318 4:48004633-48004655 AAGAGAAAATAGGAGGAGGAAGG + Intronic
973335168 4:48948647-48948669 GAGAGACATGAGGATGACTAGGG + Intergenic
974886784 4:67828997-67829019 GAGAGGAATGAGCATGAGCATGG - Intronic
974928828 4:68337128-68337150 GAGAGAGACCAGAAAGAGGAGGG - Exonic
975828734 4:78347025-78347047 GAGAGAAATGAGGATCTGGAGGG - Intronic
976278966 4:83307801-83307823 GAGAGAAAAAAGAATGAAGATGG + Intronic
976283604 4:83349278-83349300 GAGAAAAATGAGTAGGAGGATGG - Intergenic
976852331 4:89561693-89561715 GAGAGAATACAGTATGATGAGGG - Intergenic
978556847 4:109990226-109990248 GAGAAATATCAGGATGAGGAAGG + Intronic
978806008 4:112801103-112801125 GTGTGAATTCAGAATGAGGAGGG + Intergenic
978911763 4:114071582-114071604 TATAGAATTCAGGATGTGGATGG + Intergenic
979535787 4:121819082-121819104 GGGAAAATACAGGATGAGGATGG - Intronic
979541856 4:121892821-121892843 TAGAGAAATAAGGAAGAGGTTGG + Intronic
979668926 4:123342102-123342124 GAGATAAATCTGTATAAGGAAGG - Intergenic
980042362 4:127953910-127953932 GAGAGAAAACAGGATGATTGGGG + Intronic
980638014 4:135535422-135535444 GGGAGAGAGCAGGATGAGGAAGG + Intergenic
980653364 4:135749817-135749839 CAGAGAAATCAGGAAGGAGAAGG - Intergenic
980826916 4:138084617-138084639 GAGAGAAAAGAGGCTGATGAGGG + Intergenic
981006948 4:139884952-139884974 GAGAAACAACAGGATTAGGACGG + Intronic
981095572 4:140775981-140776003 GAGATAATAGAGGATGAGGAGGG - Intergenic
981978924 4:150768270-150768292 TAGAGGAATCAACATGAGGAAGG + Intronic
982101140 4:151969071-151969093 GAGAGGACACAGGATGGGGAGGG - Intergenic
982161359 4:152573249-152573271 GGGAGAAATTAGAAAGAGGATGG - Intergenic
982485770 4:155964202-155964224 CACAGAAATGAGGTTGAGGAAGG + Intergenic
982930959 4:161407371-161407393 GAGAGAAAACTGAATGAGGATGG + Intronic
983156005 4:164349742-164349764 GAAAGAAATAAGGAGGAAGATGG + Intronic
983917353 4:173307144-173307166 GAGAAAAATCAGGATGACCTTGG - Intronic
984626762 4:182015869-182015891 GAGACAAAGTACGATGAGGAGGG - Intergenic
984985957 4:185329697-185329719 GAGAGAAGAGAGGATGAGGGAGG + Intronic
985820197 5:2154398-2154420 CAGAGAACTCAGGATGCAGATGG + Intergenic
985906916 5:2845977-2845999 GAGAGAAAGGGGGATGGGGATGG + Intergenic
986625810 5:9723036-9723058 GAGTGAAAGCAGGATGGAGATGG + Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
986891433 5:12312692-12312714 GAGAGAAATCAAGGTGGGAATGG + Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
988620079 5:32814348-32814370 GACCAAAATTAGGATGAGGAGGG - Intergenic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
990193790 5:53290362-53290384 GAGAGGAGTCAGGCTGGGGATGG + Intergenic
990251434 5:53919546-53919568 GAGACAAAACAGGATGGGAAAGG + Intronic
990843928 5:60115329-60115351 CAGAGACCTCATGATGAGGAAGG - Intronic
990850135 5:60193876-60193898 GAGAGTAAGCTGGGTGAGGAAGG - Intronic
990960773 5:61391447-61391469 AAGAAATGTCAGGATGAGGATGG - Intronic
991349331 5:65704686-65704708 GAGAGAGATGAAGATAAGGAAGG - Intronic
991599732 5:68340484-68340506 GAGATTAACCAGGCTGAGGATGG + Intergenic
992292939 5:75298992-75299014 AAGAGAAAATAGGGTGAGGAAGG - Intergenic
992549470 5:77847195-77847217 GGGAGAAAAGAGAATGAGGATGG - Intronic
992569259 5:78038041-78038063 GAGAGACAACAGGATGCGGTGGG + Intronic
992572741 5:78076563-78076585 GAGATAACTCAGGATAAGGCTGG + Intronic
993484715 5:88468781-88468803 GACAGGAACCAGGAAGAGGAAGG - Intergenic
993504938 5:88697193-88697215 GAGAAAAATGAGGATGAGAGAGG - Intergenic
993626395 5:90229709-90229731 GCCAGAAATAAGGATGAGGGTGG - Intergenic
993904257 5:93605178-93605200 GTGAGAAATCAGGATGGGAGAGG + Intergenic
994176520 5:96717919-96717941 GAGACAAATAAGGGTAAGGATGG + Intronic
994781810 5:104098575-104098597 GAGCAAAAAAAGGATGAGGACGG - Intergenic
994916541 5:105987742-105987764 AAAAGAAATCAGGATGAGAAAGG + Intergenic
994924016 5:106090020-106090042 GAGATAAATTAGGATGAGAATGG + Intergenic
995122017 5:108546301-108546323 GAGGAAAAGCAGGATGAGAACGG - Intergenic
995865284 5:116683824-116683846 GAGAGAGATAAGATTGAGGAAGG - Intergenic
996779157 5:127165878-127165900 GAGAGCAATAAGGATGAAAAGGG + Intergenic
997047356 5:130334019-130334041 TAAAGAAATAAAGATGAGGATGG - Intergenic
997158594 5:131583631-131583653 GACACAAATCAGTATGTGGAAGG - Intronic
997834001 5:137177784-137177806 GAGAGAAATGAGGAGTGGGAGGG + Intronic
997929582 5:138061299-138061321 GAGAGGACTCAGGATGGGGGAGG - Intergenic
997984002 5:138489457-138489479 GGGAGAAAGCAAGAAGAGGAGGG - Intergenic
998019872 5:138760282-138760304 GAAAGAAATCCGGCTGAGCACGG - Intronic
998728025 5:145041372-145041394 GAGAGAAAACCAGATGAGTATGG + Intergenic
999518269 5:152322741-152322763 GATAGAAATGAGCATGAGGAGGG - Intergenic
999617969 5:153445271-153445293 GAAAGAAACTAGGATGAGGTAGG - Intergenic
999833321 5:155341598-155341620 CAGAGAGAGAAGGATGAGGAAGG + Intergenic
999891467 5:155982552-155982574 GAGAGAGAGCTGGCTGAGGAAGG - Intronic
1000484363 5:161821652-161821674 GAGAGAAAGAGGGATGAGTAGGG - Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000637494 5:163660443-163660465 GACAGAAAGCAGGATGGAGAAGG + Intergenic
1001171576 5:169424402-169424424 GACAGAAACAAGGAGGAGGATGG + Intergenic
1001427384 5:171632132-171632154 GAGGGAAATCATGATGATGATGG - Intergenic
1001904853 5:175463180-175463202 GAGAGGAAGCAGGATTAGGCAGG + Intergenic
1001950306 5:175811998-175812020 GAGAGAAGACAGGGTGAGGCTGG + Intronic
1001968258 5:175930565-175930587 GAGAGAAATCAAAATAAGGATGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002249184 5:177913225-177913247 GAGAGAAATCAAAATAAGGATGG - Intergenic
1002723284 5:181278849-181278871 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1002966733 6:1974074-1974096 AAGAGAAATCGAGGTGAGGAAGG - Intronic
1003576100 6:7296741-7296763 GAGGGAAATAAGGATGTGGTAGG + Intronic
1003710880 6:8588394-8588416 GTGAGAGATAAGGGTGAGGATGG + Intergenic
1004601729 6:17156886-17156908 GAAAGAAATGGGGAGGAGGAGGG - Intergenic
1004854236 6:19733186-19733208 GAAAGAAATAGGAATGAGGAGGG - Intergenic
1004901196 6:20195894-20195916 GAGACAAAGCAGGCTGAGAAGGG + Intronic
1006112916 6:31759614-31759636 GACAGAGAGCAGGAAGAGGAGGG - Intronic
1006267371 6:32936455-32936477 GGAAGAAATGAGGAAGAGGAAGG - Intronic
1006509914 6:34516112-34516134 GAGAGAAAGCAGGTGGAGAAGGG - Intronic
1006603281 6:35239617-35239639 GAGAGAGATCAAGAAGAGGCAGG + Intronic
1006938322 6:37733924-37733946 ACAAGAAATGAGGATGAGGATGG + Intergenic
1007017467 6:38483128-38483150 CAGAGAAATGATGAAGAGGATGG - Intronic
1007133721 6:39500590-39500612 GAGAGAACCCAGGAGGAGAAAGG - Intronic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1007917112 6:45571590-45571612 GAGAGAAGTCAGGAGGAGACAGG + Intronic
1008401220 6:51065310-51065332 GAGGGAAATCATAATCAGGAAGG + Intergenic
1008469970 6:51873940-51873962 GGGAGACATCAGCATGTGGAAGG + Intronic
1008907445 6:56695183-56695205 GAGAGAGAGAAGGAGGAGGAGGG - Intronic
1008989482 6:57586360-57586382 GAGAGAAATTAGGCTGAGAGGGG + Intronic
1009178066 6:60484913-60484935 GAGAGAAATTAGGCTGAGAGGGG + Intergenic
1009347912 6:62639490-62639512 GAGAGAATTTAAGATGAGAAAGG - Intergenic
1009567329 6:65325436-65325458 GAGAGAAATGAGGCATAGGAGGG + Intronic
1009979292 6:70708107-70708129 GAGAGGAAACAGGAAGAGGGAGG - Intronic
1010802744 6:80196725-80196747 GGGAGAAAAAAGGAGGAGGATGG + Intronic
1010950463 6:82030869-82030891 GAAAGCAATCAGCACGAGGAGGG + Intergenic
1011193885 6:84763382-84763404 CAGAGAAATCAAGAGGAGAAGGG + Intronic
1011266316 6:85523316-85523338 GATAGAGAGCAGGAGGAGGATGG + Intronic
1011514344 6:88136035-88136057 GAGAGTAATGAGGATGAGGGCGG - Intergenic
1011840314 6:91489541-91489563 AAAAGAAATCAGGCTAAGGAAGG - Intergenic
1012141845 6:95635316-95635338 GAGAGACATCAGGGAGATGACGG + Intergenic
1014488734 6:122035767-122035789 GAAAGAAAGCAGGAAGAAGAGGG - Intergenic
1014495042 6:122111094-122111116 GAAAGCAATCATGAGGAGGAGGG - Intergenic
1014735256 6:125086990-125087012 GAGAAAAATGAGGTTGAAGAGGG - Exonic
1015397210 6:132748142-132748164 GAGAGAAATCAGGGTCACCAAGG - Intronic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016183193 6:141171795-141171817 GAGAGAAAGCAAGGGGAGGAGGG + Intergenic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017245982 6:152225358-152225380 GAGATAAATAATTATGAGGAAGG - Intronic
1017335305 6:153251436-153251458 TAGAGATATCAGGAGGAAGAGGG - Intergenic
1017385729 6:153880633-153880655 TAGAAAAATCAGGAAAAGGAAGG + Intergenic
1017652070 6:156593122-156593144 GAGAGAAAGAAGGAAGAGGGAGG + Intergenic
1017954481 6:159167549-159167571 AAGAGAAATCCAGGTGAGGACGG - Intergenic
1018145951 6:160889039-160889061 AAGAGAAATTAGGGAGAGGAGGG - Intergenic
1018453722 6:163933021-163933043 TAGAGACATGAGGATGAAGAGGG + Intergenic
1018483713 6:164217670-164217692 GAGAGAAATGAGGTTGATGAGGG - Intergenic
1018786413 6:167111714-167111736 GAGACAAATAAGGTGGAGGAAGG - Intergenic
1019503186 7:1375764-1375786 AAGAAAAATCAGGCTGAGAAGGG - Intergenic
1019740577 7:2671011-2671033 CAGAGAGTTCAGGATGAGGGTGG + Intergenic
1020345580 7:7159416-7159438 GAAAGAAAACAGGAAGAGGAGGG + Intronic
1020601958 7:10286742-10286764 GAGAAAAAACAGCATGGGGAAGG + Intergenic
1021029594 7:15714773-15714795 GAGAGAAAGGAGGAGAAGGAGGG + Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022384657 7:29889990-29890012 CAATGAAATCAGGAGGAGGAGGG - Intronic
1022515269 7:30971192-30971214 GAGAGCAACCAGGATGGTGATGG - Exonic
1022668480 7:32432730-32432752 GTGAGAAATGAGAATGGGGAGGG - Intergenic
1022715342 7:32892670-32892692 GAGAGACATCTGGGTGCGGACGG + Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023828576 7:44025988-44026010 CAGTGAGATCAGGATGAGGGTGG + Intergenic
1024457538 7:49626486-49626508 GTGAGAATTCAGGAGGAGCAAGG + Intergenic
1024810979 7:53212042-53212064 GGGAGAAATCAGTAGGAGAAGGG - Intergenic
1025264952 7:57449250-57449272 GAGAGAACTGGGGATGGGGAGGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1026546586 7:71328350-71328372 GAGAGAAAGCAGGAAGAGAATGG - Intronic
1027453949 7:78363991-78364013 GAAAGAAATGAGGAAGGGGAGGG - Intronic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029738871 7:102480268-102480290 CAGTGAGATCAGGATGAGGGTGG + Intergenic
1029756872 7:102579431-102579453 CAGTGAGATCAGGATGAGGGTGG + Intronic
1029774811 7:102678491-102678513 CAGTGAGATCAGGATGAGGGTGG + Intergenic
1030205169 7:106945388-106945410 GAGAGAAAGTATGATGAGGCTGG - Intergenic
1030350855 7:108484596-108484618 GATAGAAAATGGGATGAGGAAGG - Intronic
1030422520 7:109326351-109326373 GACAGAAACAAGGAAGAGGAAGG + Intergenic
1030644559 7:112045399-112045421 GAGAAAAATGATGATGTGGAGGG - Intronic
1031450979 7:121917853-121917875 AAAAGAAACCAGGATGAGCAAGG - Intronic
1033679675 7:143582169-143582191 CAGAGAAATGAACATGAGGAGGG - Intergenic
1033692160 7:143747274-143747296 CAGAGAAATGAACATGAGGAGGG + Intergenic
1034130998 7:148717433-148717455 GAAAGAATTCAGGATGACAAAGG - Intronic
1034226751 7:149490517-149490539 GAGGGAAATGAGGATGAGTCAGG + Intronic
1035117836 7:156539756-156539778 GAGAGAGAGAAGGAGGAGGAGGG - Intergenic
1036384432 8:8266452-8266474 CATAAACATCAGGATGAGGATGG + Intergenic
1036522925 8:9508854-9508876 CAGAGATGTCAGGATGAGGGAGG - Intergenic
1037010832 8:13840237-13840259 GAGAGAAGCCAGGTTGATGAAGG - Intergenic
1037773740 8:21818941-21818963 GAGAAAGATGAGGAGGAGGAGGG - Intergenic
1038099856 8:24361259-24361281 GGGAGAAAGCAGGATTAGGCTGG + Intergenic
1038417948 8:27411276-27411298 AAGAGGATTCAGGCTGAGGAAGG + Intronic
1038535039 8:28347655-28347677 GCCTGAAAGCAGGATGAGGAAGG - Exonic
1038644694 8:29351870-29351892 AAGAGAAATGGGGATGGGGAGGG - Intergenic
1039430169 8:37519672-37519694 GGCAGGAATCAGGATGAGGCAGG - Intergenic
1039741194 8:40384453-40384475 GACAGAAAACAGTGTGAGGATGG + Intergenic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1040893671 8:52342965-52342987 GAGAGACATATGGATGAGGGAGG + Intronic
1040990770 8:53347331-53347353 GAGAGAACTAAGGAGGAGAAAGG - Intergenic
1041325729 8:56661953-56661975 GGGAGAAACCAGGGTGAGGTGGG + Intergenic
1041347096 8:56910708-56910730 GAGACAGATAAGGAAGAGGAAGG + Intergenic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1041875829 8:62685878-62685900 GAGAGAAAACAGGAAGGGGATGG - Intronic
1042344286 8:67711758-67711780 GAGAGGATTCAGGATAAAGAGGG + Intronic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1042416517 8:68526883-68526905 GACAGGAGTCAGGAGGAGGAGGG + Intronic
1042949784 8:74189145-74189167 GAAAGAAAGGAGGAGGAGGATGG - Intergenic
1043606840 8:82010839-82010861 GAGAGGACTCAAGATGAGGTTGG + Intergenic
1044110796 8:88270779-88270801 AAGAGAAATCAGGACTAGAAAGG - Intronic
1044523553 8:93226280-93226302 AAGAGAATTCAGCAAGAGGAGGG + Intergenic
1044892534 8:96852555-96852577 GAGAGAAATAAGCAGGAGCAAGG - Intronic
1046933534 8:119864931-119864953 GAGAGAAAGGAGGATGACAAAGG + Intergenic
1047028314 8:120848905-120848927 GAAAGAAAGCAGGATGGAGATGG + Intergenic
1047446828 8:124927403-124927425 GAGAGAAAACAGGGAGAGAAGGG + Intergenic
1047689769 8:127340065-127340087 GAGAGAAGTGAAGATGAGAAGGG + Intergenic
1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG + Intronic
1048305366 8:133280182-133280204 AAGAGAAGACGGGATGAGGAAGG + Intronic
1048530435 8:135243114-135243136 GAGACAGATCAGAAAGAGGAAGG - Intergenic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050216901 9:3336677-3336699 GAAAGAAATGAGGTTAAGGAAGG + Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050478542 9:6065862-6065884 GAGAGAAATGAGGCTTAGAAGGG + Intergenic
1050738695 9:8794145-8794167 GAAAGACATCAGGAAAAGGAAGG + Intronic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051498395 9:17750535-17750557 GAGAGAAATAATGATGGGCAGGG - Intronic
1051681390 9:19611371-19611393 GAGAGAGATGAGGGAGAGGAAGG + Intronic
1051998143 9:23244453-23244475 GTGAGAAATGGGGATGGGGAAGG + Intergenic
1053051479 9:34964546-34964568 TAGAGAAATAAGGAAGGGGAAGG - Intronic
1053330903 9:37206312-37206334 GAGAGAAGTGGGGAGGAGGAGGG - Intronic
1053885465 9:42642248-42642270 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1054224484 9:62449697-62449719 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1055699024 9:78920979-78921001 GAGAGAAATCAGAAGGACAAAGG - Intergenic
1056944121 9:90979187-90979209 GAGAGAAAACAGGAAATGGATGG - Intergenic
1057887146 9:98838512-98838534 GAGATAAATCGCTATGAGGAAGG - Intronic
1058432829 9:104933991-104934013 GAGAGGAATCAGTTTCAGGAAGG - Intergenic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1059035680 9:110751392-110751414 GAGAAAGACCAGAATGAGGATGG + Intronic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059578595 9:115519199-115519221 GAGAGAAATGAGGAGGAAGAAGG - Intergenic
1059963161 9:119587403-119587425 TAGAGAAGTCAGGATGAGGGAGG - Intergenic
1060242704 9:121918166-121918188 GAGAGGAATCAGTCTGTGGATGG + Intronic
1060484704 9:124039746-124039768 GAAAGTCATCAGGAAGAGGAAGG + Intergenic
1060834690 9:126746131-126746153 GAGAGAAATCATGAGGACTAAGG - Intergenic
1061204130 9:129153214-129153236 GAGAGAAAGGAGGGTGAGGTTGG + Intergenic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062251721 9:135600685-135600707 GAGAGAAATTTGGAGGGGGATGG + Intergenic
1062434199 9:136539316-136539338 GGGAGACATCAGGAACAGGAAGG - Intronic
1062638798 9:137506219-137506241 GAAAGAAAGCAGGGTGTGGAGGG - Intronic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1186269447 X:7869209-7869231 GAGAGTAATCAAGGTGGGGATGG + Intergenic
1187025670 X:15433572-15433594 GAAAGAAATGAGGAGGAGGAAGG + Intronic
1187768703 X:22671268-22671290 GAGAGAAATGAGCATGAAGGTGG - Intergenic
1188673650 X:32912049-32912071 GAGAGAGAGAAGGAGGAGGATGG + Intronic
1188697084 X:33207107-33207129 CAGACAAATGAGAATGAGGAAGG - Intronic
1189153892 X:38735506-38735528 GAGAAAAATCAGGCTGGGCATGG + Intergenic
1189270365 X:39747241-39747263 GAACAAAATCAGGATGAGGTTGG - Intergenic
1189613574 X:42763051-42763073 GAGAGAAGGGAGGATGAGGGAGG - Intergenic
1189861155 X:45273830-45273852 GAGAGAAAGAAGGATGAGACAGG + Intergenic
1190092527 X:47452042-47452064 GAGACACTGCAGGATGAGGAGGG + Intronic
1190165697 X:48071358-48071380 GAGAGATGTCAGGGTGACGAGGG + Exonic
1190536517 X:51433594-51433616 GAGAAAAATCAGCAGGAGGGGGG - Intergenic
1193039144 X:76986564-76986586 GAGAGAAAAGAGGAAGAGGAGGG - Intergenic
1193205090 X:78738929-78738951 GAGAGGCATCAAGAGGAGGAAGG + Intergenic
1193861845 X:86677832-86677854 AAGATAAATGAGGTTGAGGATGG - Intronic
1194065695 X:89259152-89259174 GAGAGAGATGATGATGGGGAAGG - Intergenic
1194640024 X:96392584-96392606 TAGAGAAATAGGGGTGAGGATGG + Intergenic
1194703286 X:97142382-97142404 GAGAGAAAACAACATGAGCAAGG + Intronic
1194742890 X:97596332-97596354 GAGAGAAAAATGGAAGAGGAGGG - Intronic
1194950779 X:100123070-100123092 GAGAGAAATGAGAATCAGGGAGG + Intergenic
1195581508 X:106509190-106509212 GAGGGAAAACAGGAAGAGTATGG - Intergenic
1195697964 X:107680650-107680672 GAGAGTAAAAAGGATGAGTAAGG - Intergenic
1196531767 X:116796240-116796262 GAGAGAAGACAAGATGTGGAAGG - Intergenic
1196556343 X:117089032-117089054 AAGAGAAATCAGGAAGACGCTGG + Intergenic
1197590078 X:128397773-128397795 GAAAGAAGTCAAGAAGAGGATGG + Intergenic
1197795499 X:130293752-130293774 GAGAGAATGCAGGATGAAAAGGG + Intergenic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1197873277 X:131080145-131080167 GAGAAAAATCTGGATGGGCAGGG - Intronic
1198121457 X:133596538-133596560 GATAAAAACCTGGATGAGGAAGG - Exonic
1198199959 X:134406443-134406465 GTGAGAACTTAGGAGGAGGAAGG + Intronic
1198315714 X:135464243-135464265 GGGAGATGCCAGGATGAGGAGGG + Intergenic
1198594964 X:138226300-138226322 GAGAGAAAAATGGAAGAGGAAGG + Intergenic
1198714322 X:139540231-139540253 GAGAAAAGTCAGAATGAGAAGGG - Intronic
1199169154 X:144716300-144716322 CTGACAAATCAGGATGAGGTGGG - Intergenic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1199453686 X:148002763-148002785 GTGAGAAAGAAGGATAAGGAAGG + Intronic
1199470223 X:148187137-148187159 GAGAAAAATGAGGATGAGAGAGG - Intergenic
1199504334 X:148544396-148544418 GAGTGAAAGCAGGGTGGGGATGG - Intronic
1199753974 X:150847530-150847552 GAGAGAAAGCAGTATCAAGATGG - Intronic
1199842615 X:151665498-151665520 GATGGAGACCAGGATGAGGAAGG + Intronic
1200719863 Y:6593282-6593304 GAGAGAGATGATGATGGGGAAGG - Intergenic
1201222721 Y:11787794-11787816 GAGAGAGATTAGGATGAGAAAGG - Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1201672913 Y:16544395-16544417 CAGAGAAATCAGTGTTAGGAAGG - Intergenic