ID: 969921947

View in Genome Browser
Species Human (GRCh38)
Location 4:10548642-10548664
Sequence GGGTGGATTAAATCAACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969921947_969921953 -2 Left 969921947 4:10548642-10548664 CCCCAAGTTGATTTAATCCACCC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 969921953 4:10548663-10548685 CCCAAATTGATTTCCTTGCATGG 0: 1
1: 0
2: 1
3: 13
4: 136
969921947_969921958 30 Left 969921947 4:10548642-10548664 CCCCAAGTTGATTTAATCCACCC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 969921958 4:10548695-10548717 CGTGGTCCTGCCCTGTGCAGAGG 0: 1
1: 0
2: 0
3: 26
4: 217
969921947_969921957 12 Left 969921947 4:10548642-10548664 CCCCAAGTTGATTTAATCCACCC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 969921957 4:10548677-10548699 CTTGCATGGTGTGAGGAACGTGG 0: 1
1: 0
2: 0
3: 9
4: 149
969921947_969921955 5 Left 969921947 4:10548642-10548664 CCCCAAGTTGATTTAATCCACCC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 969921955 4:10548670-10548692 TGATTTCCTTGCATGGTGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969921947 Original CRISPR GGGTGGATTAAATCAACTTG GGG (reversed) Intronic
900893961 1:5470065-5470087 CGGTGGATTAAACAAAATTGGGG - Intergenic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905631786 1:39522892-39522914 GGGTGGATTCAAGCCTCTTGGGG + Intronic
905665977 1:39763295-39763317 GGGTGGATTCAAGCCTCTTGGGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
907956806 1:59236578-59236600 GGTTGGATTAAATAAACTTCTGG - Intergenic
911255143 1:95624550-95624572 TGGGGGATGAAGTCAACTTGAGG + Intergenic
911417145 1:97589087-97589109 GGGTGCATTAAGTCACCTAGAGG - Intronic
918691369 1:187484205-187484227 TGGTGGTTTACATCAACTTAAGG + Intergenic
921338126 1:214108277-214108299 GTGTGGATGAAATGACCTTGTGG + Intergenic
1063529283 10:6815306-6815328 GGGGGGATTAAAACAGATTGGGG + Intergenic
1067474118 10:46555442-46555464 GGGTGGATTAAACCACCTCCTGG - Exonic
1070447549 10:76522599-76522621 GGCTGGATTTAATGACCTTGAGG + Intronic
1072970580 10:100013815-100013837 GGGAGAATTCAATGAACTTGAGG - Intergenic
1085576774 11:77612149-77612171 AGTTGGATTTAATCAAGTTGAGG - Intronic
1089679552 11:120111658-120111680 GGGTGGATTATATCATGTTAAGG + Exonic
1090878956 11:130816402-130816424 GGGTGGATGAAATGACCTTCAGG - Intergenic
1095466241 12:42490633-42490655 GGGTGGATAAACTGGACTTGTGG + Intronic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1099599046 12:84708366-84708388 GGCTGGAGTAAATCAAATGGGGG + Intergenic
1100445280 12:94654400-94654422 GGGTGGATCACTTGAACTTGAGG - Intergenic
1103074884 12:117974128-117974150 GGGTGGATCAACTGAACCTGAGG + Intergenic
1105562138 13:21502800-21502822 TGGTATATAAAATCAACTTGAGG - Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1111682874 13:91465919-91465941 ATTTGGATTAATTCAACTTGTGG - Intronic
1111973434 13:94940811-94940833 GGGTGGAATAAAGGAGCTTGTGG + Intergenic
1113227416 13:108174646-108174668 GTGTAAATTAATTCAACTTGTGG + Intergenic
1115222431 14:31071121-31071143 GGGTGAACTAAATAAATTTGGGG - Intronic
1118160886 14:63289097-63289119 GTGTGGACTAAGTGAACTTGTGG - Intronic
1122673304 14:103388894-103388916 GAGTGGATTAAAAAAAATTGTGG - Intronic
1130676356 15:85955559-85955581 GGGTAGACAAAATAAACTTGGGG - Intergenic
1131302998 15:91216201-91216223 GGGTAGATTACATCAACCCGTGG - Intronic
1133905600 16:10019598-10019620 GGGTTGATTTAATCTACTTGAGG - Intronic
1138099403 16:54240252-54240274 GGATGGATGAAACAAACTTGAGG + Intergenic
1141229590 16:82152932-82152954 GTGTGTATTAAATCAAACTGCGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1143385095 17:6524352-6524374 GGATGGAAGAAACCAACTTGAGG + Intronic
1144036191 17:11368003-11368025 GGTTAGATTAATTCAACTTTGGG - Intronic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1146982857 17:37182232-37182254 GGATGGATGAAATCCACTTCTGG - Intronic
1154488928 18:14904074-14904096 GGGTGGATGAAACCATGTTGGGG - Intergenic
1157308519 18:46534664-46534686 AGGTGGATTAAACCAAGTTCTGG - Intronic
1157628573 18:49073618-49073640 GGGTGAATTTAATCAACTCCAGG - Intronic
1159857551 18:73607227-73607249 GAGTGGATAAAGTCAACCTGTGG - Intergenic
1162137568 19:8565121-8565143 GGGTGGATCACTTGAACTTGAGG - Intronic
925249066 2:2414304-2414326 GGGTGTACTAAATCCTCTTGAGG + Intergenic
931793605 2:65688675-65688697 GGGGGTGTTAAATCAACTTCAGG - Intergenic
933477073 2:82804411-82804433 GGGAGAATGGAATCAACTTGGGG + Intergenic
933661638 2:84932385-84932407 TGGTAGATTTTATCAACTTGAGG - Intergenic
934122819 2:88856596-88856618 GTGTGGATTAAATTAGGTTGTGG + Intergenic
935982681 2:108643086-108643108 GGGTGGATTTAAGGAACATGTGG + Intronic
940769569 2:157825744-157825766 AGCTGGATTAAAGCTACTTGGGG - Intronic
941274344 2:163471946-163471968 CTGTGGATTAAATGGACTTGAGG + Intergenic
942414855 2:175747844-175747866 TGGTGGATTAACTCAGCTGGGGG - Intergenic
943597821 2:189879101-189879123 TGCTGGAGTAAATCAACTTTAGG + Intergenic
945249876 2:207756278-207756300 GCATGGATCAAATCAACTTATGG - Intronic
1169416103 20:5417660-5417682 GGATGGAGTAAAACCACTTGTGG - Intergenic
1174209902 20:48869470-48869492 GGGTGGGTTAAATCAAATATGGG - Intergenic
1177806628 21:25881493-25881515 GTGTGGATTAATTCAAGTTCAGG + Exonic
1179146926 21:38776169-38776191 GGATGGATTAAATAAATTTAAGG - Intergenic
1184925578 22:47634464-47634486 GCTAGGATTAAATCAACTTGTGG - Intergenic
952070005 3:29623153-29623175 AAGGGGATTAAATTAACTTGGGG + Intronic
952305872 3:32145560-32145582 GGCTGGATTAAAGTGACTTGAGG + Intronic
954324747 3:49857331-49857353 GGCTGGAGTAAGTCAACTTTTGG + Intergenic
956530639 3:70214160-70214182 GGGTTCATTAAATCTAATTGGGG + Intergenic
961430367 3:126877748-126877770 TGGTGGATTACATCAATTAGTGG + Intronic
962354897 3:134685509-134685531 GGTTGGAACAAAACAACTTGCGG + Intronic
962902574 3:139774152-139774174 AGGTGGCTCCAATCAACTTGAGG + Intergenic
967041740 3:185699772-185699794 GGATGGATTAAATATACTTCAGG - Intronic
969921947 4:10548642-10548664 GGGTGGATTAAATCAACTTGGGG - Intronic
971521324 4:27555396-27555418 GGGTGGGGGGAATCAACTTGAGG - Intergenic
971827718 4:31647545-31647567 AGGAGGATTAAATCAAATAGAGG - Intergenic
972116666 4:35644080-35644102 GGGTAAATTCAATCATCTTGGGG - Intergenic
979438618 4:120724338-120724360 GGGTGGAGTAGATCAAGTTGAGG + Intronic
990222431 5:53607044-53607066 TTGTGGATTAAATCAACTGCAGG - Intronic
991241038 5:64459945-64459967 GGGTGGGTTGAATCTATTTGAGG - Intergenic
998257214 5:140597304-140597326 GGCTGTATTATATCAAATTGAGG + Intergenic
998412303 5:141920861-141920883 TGGAGGATTGAGTCAACTTGAGG + Intergenic
1005981754 6:30841989-30842011 GGGTCCATTAAGTCAACTGGGGG - Intergenic
1006947320 6:37793352-37793374 GGGTGGATTATCTCTCCTTGAGG - Intergenic
1007913949 6:45543153-45543175 GGTTGGTTTTACTCAACTTGGGG - Intronic
1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1018838313 6:167501415-167501437 GGGTGGAATAAAGCAACGAGAGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1027760003 7:82265566-82265588 GAGCAGATTAAATCAACTTCTGG - Intronic
1029193310 7:98786940-98786962 GTATGTATAAAATCAACTTGAGG - Intergenic
1032126641 7:129199642-129199664 GGGAGGATTAACTGAACCTGGGG + Intronic
1038123882 8:24649360-24649382 GTCTGGAGTAAATCAGCTTGAGG - Intergenic
1040040505 8:42911992-42912014 GTGTGGATTAAATCACTTTAGGG + Intronic
1043844266 8:85146511-85146533 GGGTATTTTAAATCAAATTGAGG - Intergenic
1047407660 8:124598761-124598783 GGATGCATTAATTCAACTAGGGG + Intronic
1055286536 9:74734578-74734600 GGGAGGATTAAATTAACTACTGG + Intronic
1055734997 9:79317657-79317679 GTGTGCATTAAATCAAGTTTGGG - Intergenic
1058895163 9:109394273-109394295 GTGTAAATAAAATCAACTTGAGG + Intronic
1061839651 9:133350756-133350778 GCATGGATTAAATGAACTGGGGG - Intronic
1187767767 X:22662049-22662071 GGGTGGATTAAAGAAACTGCAGG - Intergenic
1193938286 X:87650185-87650207 AGGAGGATTACATGAACTTGGGG - Intronic
1193942723 X:87695922-87695944 CTGTGGATTAAATCATCTTAAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1196939853 X:120764647-120764669 GGGTGTAATAAATGAAATTGTGG - Intergenic
1197663858 X:129201967-129201989 TGGTGGATTAGGTCAATTTGAGG + Intergenic
1200322729 X:155206641-155206663 GAATGGATGAAATCAACTAGGGG + Intronic
1201049799 Y:9921246-9921268 GCGTGAATTATATCAACTTCAGG + Intergenic