ID: 969922911

View in Genome Browser
Species Human (GRCh38)
Location 4:10557527-10557549
Sequence CCCTAGATGCAGAGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969922911_969922920 8 Left 969922911 4:10557527-10557549 CCCTCATCCCTCTGCATCTAGGG 0: 1
1: 0
2: 0
3: 22
4: 187
Right 969922920 4:10557558-10557580 AGCCCCGCTGCTGTCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969922911 Original CRISPR CCCTAGATGCAGAGGGATGA GGG (reversed) Intronic
900822575 1:4900561-4900583 CCCTGGATGCTGAGGGATACAGG - Intergenic
902220581 1:14962000-14962022 TCCTAGATGCAGAGGGTTCTGGG + Intronic
902614804 1:17618077-17618099 CCCAAAATGCAGAGGGAACATGG - Intronic
905008088 1:34727300-34727322 ACCTAGATGCAGAAGGAAGCTGG - Intronic
905770007 1:40631322-40631344 CCATGGATACTGAGGGATGACGG - Intronic
907221427 1:52909826-52909848 CTGCAGATGCAGAGGGCTGACGG + Intronic
911399074 1:97352154-97352176 CTCTAGATCCAAAGGGATCAAGG + Intronic
912172961 1:107122789-107122811 CCGTAGATGCAGATTCATGATGG - Intergenic
917647243 1:177041234-177041256 GTCTACATCCAGAGGGATGAAGG - Intronic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
920191947 1:204199257-204199279 CCCTAGGAGCAGAGGGGAGAAGG + Exonic
920972250 1:210752936-210752958 CCCTAGAGACACAGGGGTGAAGG + Intronic
1063451058 10:6150654-6150676 CCCTAAATGCTGAAAGATGATGG + Intronic
1063567726 10:7185803-7185825 CTCTAGATGCAGAGAGGTGGAGG + Intronic
1064423539 10:15210599-15210621 ACCTAGATGAGGAGGGACGAGGG - Intergenic
1064882735 10:20074819-20074841 CCCTAGATGCAGAAAGTTAATGG - Intronic
1065051777 10:21799898-21799920 CACTAGATTCTGTGGGATGAGGG - Intronic
1065130288 10:22613313-22613335 AGCGAGATGAAGAGGGATGAGGG + Intronic
1065768508 10:29054691-29054713 CACTAGTTTCAGAAGGATGAGGG - Intergenic
1066501164 10:35996207-35996229 TCCGAGAACCAGAGGGATGATGG + Intergenic
1067580424 10:47442088-47442110 CCCTCAAAGCAGAGGGGTGAGGG - Intergenic
1069863540 10:71486223-71486245 CCCTAGATGCAGAGGAGACAGGG - Intronic
1071432450 10:85617168-85617190 CTCTAGCTTCAGAGGAATGAAGG - Intronic
1071808595 10:89152658-89152680 CCACAGATGCAGAGGGACAAAGG - Intergenic
1073590775 10:104755672-104755694 ACCTAGAAGCAGAGGTATGCTGG + Intronic
1074590288 10:114806352-114806374 CACTAGAGACAGAGGGTTGAAGG + Intergenic
1076038332 10:127220580-127220602 CCCTAGCTGTAAAGGGAAGAAGG + Intronic
1077383926 11:2260204-2260226 CCAAAGATGCAGAGGGATGTCGG + Intergenic
1077493051 11:2870947-2870969 CCAAAGGTGCAGAGGGAAGAGGG - Intergenic
1078467139 11:11558754-11558776 CCCAAGATGAAGAGGCAGGAAGG - Intronic
1078478474 11:11655556-11655578 CAGTAGCTGAAGAGGGATGAAGG + Intergenic
1078884641 11:15488344-15488366 CCCTAGCTTCAGAGGGAGGCAGG - Intergenic
1081388897 11:42504987-42505009 CCCTAGACACATAGGGATTATGG + Intergenic
1082877301 11:58001329-58001351 GTCTAGAGGCACAGGGATGAGGG - Intergenic
1083140073 11:60714473-60714495 CCCCACATTCAGAGGGATGGTGG + Intronic
1083940812 11:65894481-65894503 CCACAGATCCAGAAGGATGAGGG - Intronic
1084640603 11:70423702-70423724 GCCTAGCTGCAGAGGGAGGGTGG + Intronic
1084668622 11:70592210-70592232 CCCTGCGTGCAGAGGGAAGACGG - Intronic
1085257181 11:75181765-75181787 CCCTGGATGGAGAGGGCTGCTGG - Intronic
1085454584 11:76658545-76658567 CCCTGGAGACAGAAGGATGAAGG + Exonic
1085657730 11:78332015-78332037 TCCTAGAGGCAAAGGGAGGAGGG - Intronic
1087464362 11:98486289-98486311 CCATAGATACAGAGGGCTAATGG - Intergenic
1088415242 11:109581407-109581429 CCCTTGATGCATGGGGATTATGG + Intergenic
1089003810 11:115074261-115074283 TCCTAGATTCACAGGCATGAAGG + Intergenic
1089177846 11:116561213-116561235 CCCTGGAGGTAGAGGGAGGATGG - Intergenic
1089868115 11:121649693-121649715 CCCTAGAAGAAGGGGCATGAAGG + Intergenic
1090542346 11:127722239-127722261 CCTTAGACCCAAAGGGATGAGGG + Intergenic
1090966451 11:131601529-131601551 CTCTAGTTGAAGAGGGATTAGGG + Intronic
1091636031 12:2197326-2197348 CACAAGATGCAGGGGGATGGGGG - Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1093604741 12:21076211-21076233 CCCTATATTCATAGGGAAGAAGG - Intronic
1095250035 12:39968376-39968398 CCCAAGATGCATGGGGATTATGG + Intronic
1095922982 12:47549496-47549518 GCCTAGAAGGAGAGTGATGAGGG + Intergenic
1096215691 12:49796497-49796519 CCCTAGCTGGAGAGGGCAGAAGG + Exonic
1096869302 12:54583440-54583462 GACTAGATGCAGAGGGATGGAGG - Intronic
1097055210 12:56244988-56245010 TCCTAGAGGAAGAGGGAGGAGGG + Exonic
1097137927 12:56875009-56875031 CCCTAGTTTCAGAGGGAGGCTGG + Intergenic
1099820948 12:87709186-87709208 CCCTAGATACATGGGGATTATGG + Intergenic
1099831583 12:87850229-87850251 AAATACATGCAGAGGGATGAGGG + Intergenic
1101918686 12:108915749-108915771 CCCCAAATACAGAGGGATGGGGG - Intronic
1104630300 12:130395088-130395110 CCTTAGAAGCAGCGGGAGGAAGG + Intergenic
1106916392 13:34520059-34520081 CCCTGGAGACAGAGGGATGAAGG + Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108637259 13:52347863-52347885 ACCTAAATGCAGAGTGATGCAGG + Intergenic
1112451118 13:99510489-99510511 CCCCAGAAGCAGAGTGATGTCGG - Intronic
1112476074 13:99731723-99731745 CCCTGGATGGGGAGGGAGGAAGG + Intronic
1113252872 13:108473154-108473176 CCCCACATGTAGAGGGATGGAGG + Intergenic
1117499690 14:56339527-56339549 CCCTAGTTGCTGAAGGAAGATGG - Intergenic
1117562698 14:56958579-56958601 CCCTAGCTGCAGAGGGCTGTGGG - Intergenic
1119501964 14:75136812-75136834 CCCTGTATGCTGAGGAATGAAGG + Intronic
1121266449 14:92605626-92605648 CCCTAGAGTCAGTGTGATGAAGG + Intronic
1125155439 15:36579779-36579801 GCCTTGGTGCCGAGGGATGAGGG - Exonic
1125398845 15:39278687-39278709 CCCTAGACACATAGGGATTATGG + Intergenic
1125956403 15:43793639-43793661 GACAAGATGCAGGGGGATGAAGG - Exonic
1127569111 15:60223583-60223605 CCCAGAATGCAGAGGGTTGAGGG - Intergenic
1128255124 15:66190675-66190697 CCCGAGATTCAGTGGGGTGAAGG - Intronic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1128530521 15:68442202-68442224 CCCAAGATGCAGAGCGGTCAAGG - Intergenic
1130654948 15:85786120-85786142 CACTAGCTGCAGAGGTATAAAGG + Intronic
1132077246 15:98832066-98832088 CCCAAGAAGCAGAGGAATGAAGG - Intronic
1132933393 16:2469761-2469783 CCACAGATGCACAGGGATGGGGG - Intergenic
1133414831 16:5598273-5598295 CCCTAGATGCAAAGTGTTGCTGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1136588295 16:31201965-31201987 CCCCACATGCAGTGGGATGAGGG + Exonic
1136598520 16:31268171-31268193 CCCTAGGTGGAGAGGGAAGCTGG - Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138127591 16:54451818-54451840 CACTATATGCAGAAAGATGAAGG + Intergenic
1140230373 16:73112816-73112838 CCCTGGATGCAGAGGAATGTGGG - Intergenic
1141801750 16:86314525-86314547 CCCCAGATAAAGAGGGATCAAGG - Intergenic
1142398210 16:89845064-89845086 CCCTACTTGCAGAAGGATGATGG - Intronic
1145960188 17:28882690-28882712 CCCTGGGGGCAGAGGGATCAAGG + Exonic
1146469111 17:33110394-33110416 TTCCAGATGCAGAGGGACGAAGG - Intronic
1147159587 17:38562449-38562471 CCCTAGACGCAGCAGGATGGAGG - Intronic
1148720020 17:49745121-49745143 CCACAGATACAGAGGGCTGATGG + Intronic
1150572011 17:66394676-66394698 CCCTTGATACATAGGGATTATGG - Intronic
1152908081 17:82980933-82980955 CCCTAGATACCGCAGGATGAGGG - Intronic
1153680520 18:7496296-7496318 AGCTAGATGGAGAAGGATGAGGG - Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1160628686 18:80230518-80230540 CCCAAGATCCAGAGTGATGATGG + Intronic
1161838321 19:6662994-6663016 TCCTAGAGGCAGAGGGATGGAGG - Intronic
1161875271 19:6903664-6903686 ACCTAGATGCAGAGGGTTCTAGG + Intronic
1162583596 19:11545606-11545628 CCCAAGCTGCAGGGAGATGAGGG + Intronic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1164598053 19:29543014-29543036 CCCTAAAGGCTGAGGGATTAGGG - Intronic
1165061307 19:33206580-33206602 CCCTAGAAGCAGTGGGCGGAGGG - Exonic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
928284248 2:29975181-29975203 CTCCAGAGGCAGAAGGATGATGG + Intergenic
930522239 2:52482034-52482056 CCATAGAGGCAGAGGGTAGAAGG + Intergenic
930552914 2:52858355-52858377 ACCTAGATGCCCAGTGATGATGG + Intergenic
935605089 2:104963981-104964003 CCACAAATGCAGAGGGATGATGG - Intergenic
936025211 2:109026501-109026523 CCCTTGCTTCAGAGGGAAGAGGG - Intergenic
937267074 2:120623401-120623423 CCCTACAGGCTGAGGGCTGAGGG + Intergenic
939217641 2:139260187-139260209 CCCTAGAGGCAGAGAGAGCAGGG + Intergenic
941585241 2:167350570-167350592 CGCTGGATGCAGAGGGAACAGGG - Intergenic
942078807 2:172381518-172381540 GGCAAGATGCAGATGGATGAAGG - Intergenic
944681853 2:202084394-202084416 CTCTGAATGCAGAGGCATGAAGG - Intronic
946032295 2:216714757-216714779 ACCTAGAGGCAGAGGCCTGAGGG + Intergenic
946063853 2:216969135-216969157 CCCCAGAGGCATAGGGCTGATGG + Intergenic
947098525 2:226593310-226593332 CCCTAGATACAGAGGGTTACAGG - Intergenic
1169275065 20:4228187-4228209 CCCTACATCCAGAAGGATGAGGG - Intronic
1172137556 20:32697477-32697499 CCCCTGAAGCAGAGGAATGAGGG + Intergenic
1173105047 20:40125700-40125722 CCCGTGATTCACAGGGATGATGG - Intergenic
1173780009 20:45748022-45748044 CCCTAGATGTGGAGGAAAGAAGG + Intronic
1176370135 21:6057433-6057455 GGCTAGATGCAGAGAGATGGGGG + Intergenic
1178251167 21:31004611-31004633 TCCAAGATGCAGAGGGAGCAAGG + Intergenic
1179753384 21:43481108-43481130 GGCTAGATGCAGAGAGATGGGGG - Intergenic
1179945199 21:44669493-44669515 CCCTTGATGCTGAGGGGTGGAGG - Intronic
1180244568 21:46538466-46538488 CCCGAGCTGCAGAGAGAGGATGG - Exonic
1183108107 22:35629082-35629104 TGCTGGATGCAGAGGGATGGGGG - Intronic
1184941630 22:47770947-47770969 AATTAGATGCAGAGGGTTGATGG - Intergenic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
1185172932 22:49304105-49304127 CCCTAGGTGAAGTGGGCTGAGGG + Intergenic
1185279283 22:49963017-49963039 CCCTGGATGCTGGGGGCTGACGG + Exonic
1185414367 22:50701684-50701706 CCTTAGGTTCAGCGGGATGAGGG + Intergenic
951296104 3:20936821-20936843 ACCTGGTTGCAGAGAGATGATGG + Intergenic
952902739 3:38120758-38120780 CCCTGTGTGCAGAGAGATGAGGG + Intronic
955482535 3:59404186-59404208 CCTTATAGGCAGAGGCATGAGGG - Intergenic
957161348 3:76613577-76613599 CCCTAAGTGCAGAGAGAAGACGG + Intronic
959401158 3:105903888-105903910 CCCTTGATGCATGGGGATTATGG - Intergenic
959605236 3:108235088-108235110 CCCTAGAAGTAGGGAGATGAAGG - Intergenic
961484387 3:127206971-127206993 CCCAAGAGGCAGAGAGAGGAGGG - Intergenic
964801879 3:160565897-160565919 CCCTAGATGCCGGGGGTTCAGGG + Intergenic
965635780 3:170778994-170779016 CCATGGATGCAGAGGGCTGATGG + Intronic
969922911 4:10557527-10557549 CCCTAGATGCAGAGGGATGAGGG - Intronic
970939196 4:21611453-21611475 CCCTAGATACATGGGGATTATGG + Intronic
972152680 4:36113699-36113721 TCCAAGATGCCTAGGGATGAAGG - Intronic
975103329 4:70539567-70539589 CCCAAAATGCAGAGGAAAGAAGG - Intergenic
975675648 4:76824821-76824843 CCCCTGATGCAGATGGCTGAGGG - Intergenic
976412750 4:84735381-84735403 CCTTAGCTGCAGAGGGCCGACGG + Intronic
977584420 4:98759479-98759501 CCCTAGATCCAGCCAGATGATGG - Intergenic
978260109 4:106745848-106745870 CCCCAGGTGTAGAGGGATGGGGG + Intergenic
979438172 4:120719866-120719888 CCCCTGATGCAGAAGGATAATGG - Intronic
979703525 4:123694091-123694113 CCTTGGATACTGAGGGATGAGGG + Intergenic
983074129 4:163304180-163304202 CCCTAGATGGTGAAGGGTGAAGG + Intergenic
986539218 5:8826733-8826755 ACCTAGAGGCAGACGGCTGAGGG + Intergenic
986570346 5:9157591-9157613 CTCTAGATGCAGTGAGATGTGGG - Intronic
987498919 5:18681158-18681180 CCCTTGATGCATGGGGATTATGG - Intergenic
988785315 5:34561389-34561411 TCTTAGATCCAGAGGGAGGAAGG - Intergenic
990855907 5:60266082-60266104 AACTAGATGCAGCGGGAAGAAGG + Intronic
991298622 5:65105998-65106020 TCCAAGATGCACAGAGATGAGGG + Intergenic
994745111 5:103668402-103668424 ACGCAGATGCAGAGGGTTGAAGG - Intergenic
997442133 5:133916252-133916274 GCTGAGATGCATAGGGATGAGGG + Intergenic
997679520 5:135739621-135739643 CCCTAAATCCAGCAGGATGATGG - Intergenic
1001041550 5:168339268-168339290 CTCTAAGAGCAGAGGGATGAGGG + Intronic
1001476717 5:172055673-172055695 CCCAAGATCCAGAGGAGTGAGGG - Exonic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1004891095 6:20101452-20101474 CCATGGAGGCAGAGGGATCATGG - Intergenic
1007213819 6:40220311-40220333 CCCTGAATCCAGTGGGATGATGG + Intergenic
1012030049 6:94048371-94048393 CCCTAGAGGCCCAGGGTTGAGGG + Intergenic
1013819299 6:114135594-114135616 CCCTGGGTGGAGAGGGAGGATGG - Intronic
1015631572 6:135236932-135236954 CTCTAGATGCAGCGAGATGAAGG + Intergenic
1018067587 6:160134471-160134493 CGCATGATGCATAGGGATGAGGG + Intronic
1018381200 6:163259858-163259880 CCCCAGAGGCTGAGGGATGAGGG + Intronic
1018683199 6:166281859-166281881 CCCCAGGTGCAGAGGCAGGAGGG - Intergenic
1019514125 7:1432346-1432368 CCCCAGATGCAGGGGGCTGATGG + Intronic
1021645300 7:22783693-22783715 GCCACGATGCAGAGGAATGATGG + Intergenic
1024352207 7:48377976-48377998 CCTTAGATGCTGATGGTTGAGGG - Intronic
1026740387 7:72975409-72975431 CCACAGATGGAGAGGGATGATGG + Intergenic
1026797689 7:73376895-73376917 CCACAGATGGAGAGGGATGATGG + Intergenic
1027103344 7:75389661-75389683 CCACAGATGGAGAGGGATGATGG - Intergenic
1028920643 7:96306739-96306761 AACAAAATGCAGAGGGATGAAGG - Intronic
1029177039 7:98672111-98672133 CCCTGGATCCAGAGAGAAGATGG + Intergenic
1030783724 7:113634034-113634056 CCCTAGACACACAGGGATTATGG + Intergenic
1031023550 7:116654427-116654449 CCTTAGATGCAAAGGAATGCAGG + Intergenic
1031343991 7:120641575-120641597 CCCCAGATGCAGTGGGCTGAAGG + Intronic
1032592268 7:133202707-133202729 CCATAGATGCAGAAGGAACAGGG + Intergenic
1037583209 8:20258794-20258816 CCCCAGATCCATAGGGATGATGG - Intronic
1038097444 8:24330646-24330668 CCCTAGCTTCAGTGGGCTGAGGG - Intronic
1039099997 8:33930586-33930608 ACCTGGATGAAGAGGGAAGAAGG - Intergenic
1044044129 8:87409295-87409317 CTCTAGATGCTGAGGCTTGAGGG - Intronic
1044799222 8:95936329-95936351 CCCTGAGTGCAGAGAGATGAAGG - Intergenic
1057045323 9:91881817-91881839 CCTGAGATGAAGAAGGATGAGGG + Intronic
1057219224 9:93247085-93247107 CCCGAGTTGCAGATGGAGGAAGG - Intronic
1057324948 9:94053579-94053601 CCCTACATGATGAGGGATGTGGG + Intronic
1060374968 9:123109346-123109368 CCCTTCATGCAAAGGGATGGAGG - Intergenic
1185574604 X:1161061-1161083 CCCACGATACAGAGGGATTATGG + Intergenic
1185886205 X:3785598-3785620 CCCTCAATGCACAGGGATTATGG - Intergenic
1185931907 X:4212916-4212938 CCCTTGATACATAGGGATTATGG - Intergenic
1186019100 X:5234378-5234400 ACCCAGATGAAAAGGGATGAGGG - Intergenic
1187428625 X:19201813-19201835 TCCTAGATGCACAGGCAAGAAGG - Intergenic
1189850743 X:45173922-45173944 CCCAGGGTGCAGAGGAATGAGGG - Intronic
1194297563 X:92144765-92144787 AAATTGATGCAGAGGGATGAAGG + Intronic
1199381209 X:147174507-147174529 CACAAGGTGCAGAGTGATGAGGG - Intergenic
1199531009 X:148847599-148847621 CTCTAGATCCAGAGAGTTGATGG + Intronic
1199843330 X:151672823-151672845 CCACACATGCAGAAGGATGATGG - Intronic
1200615137 Y:5369666-5369688 AAATTGATGCAGAGGGATGAAGG + Intronic
1201227590 Y:11833221-11833243 CCCTTGATGCATGGGGATTATGG + Intergenic
1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202463029 Y:25126910-25126932 CCTTCTATTCAGAGGGATGATGG - Intergenic