ID: 969923108

View in Genome Browser
Species Human (GRCh38)
Location 4:10559427-10559449
Sequence CTGGAGAAATTGAAAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 387}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969923108_969923113 -8 Left 969923108 4:10559427-10559449 CCATCAGCTTTCAATTTCTCCAG 0: 1
1: 0
2: 2
3: 47
4: 387
Right 969923113 4:10559442-10559464 TTCTCCAGGGTTACCTTGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 133
969923108_969923119 8 Left 969923108 4:10559427-10559449 CCATCAGCTTTCAATTTCTCCAG 0: 1
1: 0
2: 2
3: 47
4: 387
Right 969923119 4:10559458-10559480 TGTGGGGACTGGGGTGCCAGAGG 0: 1
1: 0
2: 1
3: 87
4: 603
969923108_969923115 -3 Left 969923108 4:10559427-10559449 CCATCAGCTTTCAATTTCTCCAG 0: 1
1: 0
2: 2
3: 47
4: 387
Right 969923115 4:10559447-10559469 CAGGGTTACCTTGTGGGGACTGG 0: 1
1: 0
2: 1
3: 16
4: 125
969923108_969923117 -1 Left 969923108 4:10559427-10559449 CCATCAGCTTTCAATTTCTCCAG 0: 1
1: 0
2: 2
3: 47
4: 387
Right 969923117 4:10559449-10559471 GGGTTACCTTGTGGGGACTGGGG 0: 1
1: 0
2: 0
3: 11
4: 154
969923108_969923112 -9 Left 969923108 4:10559427-10559449 CCATCAGCTTTCAATTTCTCCAG 0: 1
1: 0
2: 2
3: 47
4: 387
Right 969923112 4:10559441-10559463 TTTCTCCAGGGTTACCTTGTGGG 0: 1
1: 0
2: 3
3: 20
4: 267
969923108_969923120 9 Left 969923108 4:10559427-10559449 CCATCAGCTTTCAATTTCTCCAG 0: 1
1: 0
2: 2
3: 47
4: 387
Right 969923120 4:10559459-10559481 GTGGGGACTGGGGTGCCAGAGGG 0: 1
1: 1
2: 9
3: 90
4: 540
969923108_969923111 -10 Left 969923108 4:10559427-10559449 CCATCAGCTTTCAATTTCTCCAG 0: 1
1: 0
2: 2
3: 47
4: 387
Right 969923111 4:10559440-10559462 ATTTCTCCAGGGTTACCTTGTGG 0: 1
1: 0
2: 2
3: 21
4: 199
969923108_969923116 -2 Left 969923108 4:10559427-10559449 CCATCAGCTTTCAATTTCTCCAG 0: 1
1: 0
2: 2
3: 47
4: 387
Right 969923116 4:10559448-10559470 AGGGTTACCTTGTGGGGACTGGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969923108 Original CRISPR CTGGAGAAATTGAAAGCTGA TGG (reversed) Intronic
901014562 1:6220730-6220752 GTGGAGAAATGGAAAACTGCTGG - Exonic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
901329604 1:8395561-8395583 CTGGAGACATTTGAAGCTGGAGG + Intronic
901570086 1:10153099-10153121 CAGGAGAACTGGAAAACTGAAGG - Intronic
902483021 1:16721687-16721709 CTCGAGAAATAGAAAGGTGCTGG - Intergenic
902571592 1:17350630-17350652 CTGCAGAAATCCAAGGCTGAAGG + Intronic
903670316 1:25031431-25031453 CTGGAGAGATGGAAAGATGGAGG + Intergenic
905206406 1:36345128-36345150 CTGGAGCATTTGAAAGCTCTTGG + Intronic
905285605 1:36878148-36878170 CTGGAGACACTGAAAGCTCCTGG + Intronic
905645726 1:39623972-39623994 AGAGAGAAATTGAAAGCTGCAGG - Intergenic
907089292 1:51709545-51709567 CTGGAGAAGATCAAGGCTGATGG + Intronic
907823056 1:57989523-57989545 CAGGAGAAATTGAGGGGTGAGGG - Intronic
907907399 1:58795883-58795905 CTGGAGAAATGGGGGGCTGAGGG + Intergenic
908100297 1:60784190-60784212 CTGTAGAAATTGTAAACAGAAGG - Intergenic
908560769 1:65303922-65303944 CTGATCAAAGTGAAAGCTGAAGG - Intronic
908890815 1:68845261-68845283 CTGGAGGAGTTGAAAGTTGGAGG + Intergenic
909967809 1:81938902-81938924 AAGGAGAAAGTGAAAGCTAAAGG - Intronic
910297320 1:85662396-85662418 TTGTAGAAATTTAGAGCTGAAGG - Intronic
911380844 1:97112230-97112252 CTGGAGAAATGGTTTGCTGAAGG - Intronic
912226039 1:107735108-107735130 CTGGGTAAATTAAAAACTGAAGG + Intronic
912260024 1:108101628-108101650 ATGGAGAAATTCAAAGTTGTGGG + Intergenic
912369602 1:109163855-109163877 AGGGAGAAATTCAAGGCTGAAGG + Intronic
913243673 1:116852538-116852560 CTGCAGAGATTGACAACTGAAGG + Intergenic
913544864 1:119858247-119858269 CTGAAGAAATTGCAATCTGCAGG - Intergenic
914815707 1:151060458-151060480 CTGGAGAAATACAAAGCTGTTGG - Exonic
915069260 1:153252562-153252584 ATGGAGAAACTGAGATCTGAGGG + Intergenic
915307739 1:154990346-154990368 CTGCAGATGTTGGAAGCTGAGGG + Exonic
915447424 1:155981885-155981907 CTGGAGAATCTGAAAGCTGATGG - Intronic
915648581 1:157291468-157291490 GTGGAGAAAATGAAGTCTGAAGG + Intergenic
916179753 1:162073035-162073057 CTGCAGAGATTGAAAGGTGTGGG + Intronic
916383254 1:164237183-164237205 TTGAAGATATTGTAAGCTGAGGG - Intergenic
916755076 1:167761636-167761658 CTAGGGAAATGGAAAGCAGATGG + Intronic
916919512 1:169449338-169449360 CTAGAGAAATTGGAAGCTTATGG - Intronic
917470402 1:175321614-175321636 GAGGAGAAATTGAAAGGTCACGG + Exonic
917953113 1:180062331-180062353 CAGGAGAAATTGAAGTCTGCAGG + Exonic
918716046 1:187788296-187788318 CTGGAGAAATAGGAAGCAGGCGG - Intergenic
918766188 1:188486767-188486789 CTGGAAAATTTGATATCTGAAGG + Intergenic
920575787 1:207059399-207059421 CTGGAGAAAGTGAAGACTCAGGG + Intronic
921555215 1:216590627-216590649 TTGGAGAAAATGAAGGCAGAAGG + Intronic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
922436064 1:225607813-225607835 CTGGAGACACTGACAGCTGAGGG + Intronic
923351788 1:233114614-233114636 CTGGATAAACAGAAAACTGATGG + Intronic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
924620402 1:245655187-245655209 ATGGAGAAATGAAAAGCTCAGGG - Intronic
1062943608 10:1443506-1443528 CTGAAGAACTTGAAAACTGAAGG - Intronic
1063293243 10:4773441-4773463 CTGCAGAAAATGGAAGCAGAAGG + Intergenic
1063599772 10:7469868-7469890 CTAGAGACACGGAAAGCTGATGG + Intergenic
1063802712 10:9598785-9598807 ATGGAGAAATGGACAGGTGAAGG - Intergenic
1065407386 10:25384342-25384364 CTGGAGCCATTGAAAGTTTATGG - Intronic
1065409489 10:25408362-25408384 ATGGACAAATTGAAACATGATGG - Intronic
1066511289 10:36099467-36099489 CTGGAGAAATTCAAAGATAAAGG + Intergenic
1067429788 10:46235535-46235557 ATTAAGAAATGGAAAGCTGAGGG - Intergenic
1067517217 10:46961595-46961617 CTGGAGGAATTTGAAGCTGGTGG - Intronic
1067645031 10:48090234-48090256 CTGGAGGAATTTGAAGCTGGTGG + Intergenic
1069780996 10:70955230-70955252 CTGGAGAAAGCGAGACCTGAAGG - Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071584421 10:86805759-86805781 CCTTAGAAAATGAAAGCTGAAGG - Intronic
1073465029 10:103689814-103689836 CTGGTGACCTTGAAAACTGAAGG - Intronic
1074927379 10:118086941-118086963 CTGGAATAATTTAAAGCAGAAGG + Intergenic
1075478964 10:122762984-122763006 CTGGAGAAATTAAATCCCGAAGG - Intergenic
1077701409 11:4445403-4445425 CTGGAAAGAGGGAAAGCTGATGG + Intergenic
1078480192 11:11668773-11668795 CCAGAGAACTTGGAAGCTGAGGG - Intergenic
1078487282 11:11735355-11735377 CTAGAGAAATTGAGAGCCAAAGG - Intergenic
1078849742 11:15152745-15152767 CTGGAGGGCCTGAAAGCTGAAGG + Intronic
1080290297 11:30663615-30663637 ATGACGAAAGTGAAAGCTGAAGG + Intergenic
1081785491 11:45743986-45744008 CTGGAGAATTTAAATTCTGAAGG + Intergenic
1081902470 11:46640850-46640872 CTGGAGCACTTGAACGCTGCTGG + Intronic
1083315616 11:61813364-61813386 CGGGAGAAGATGAAAGGTGAGGG + Intronic
1083727254 11:64635034-64635056 CTGGAGAAATTCGAATCAGATGG + Intronic
1085714258 11:78857888-78857910 CTAGCAAAATTAAAAGCTGATGG - Intronic
1085932301 11:81098168-81098190 CTGAAGAAGCTGATAGCTGAAGG + Intergenic
1086834759 11:91607086-91607108 ATGGAAGAATTGAAAGATGAGGG - Intergenic
1087058976 11:93960098-93960120 CTGGAGAAATAAAAAGCCAAGGG + Intergenic
1088392462 11:109329889-109329911 CTGAAGAAACTGAAAGTTGCTGG - Intergenic
1088398518 11:109396262-109396284 CTCAAGAAAAGGAAAGCTGAAGG + Intergenic
1088531983 11:110820290-110820312 CTGGAGAAATTCTAGGTTGATGG + Intergenic
1088718547 11:112571883-112571905 CTGGGGAAATTGAACAATGATGG + Intergenic
1089449668 11:118584541-118584563 GTGGACAAATTAAAATCTGAAGG + Exonic
1090069241 11:123529277-123529299 TTGGAGTAATTGAAATGTGAGGG + Intronic
1090490184 11:127153823-127153845 ATGAAGAAATTGAAACCTCAAGG - Intergenic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1092925825 12:13271182-13271204 CTGGAGAATGAAAAAGCTGATGG - Intergenic
1094795633 12:33968631-33968653 CTGGAGCTATTCAAAGCTGAAGG + Intergenic
1095108421 12:38262844-38262866 CTGGAGCTATTCAAAGCTGAAGG + Intergenic
1098454010 12:70652053-70652075 CTGGACAGATTCAGAGCTGAAGG + Intronic
1098701434 12:73632796-73632818 CTGAAGGAATTCAGAGCTGACGG - Intergenic
1098883170 12:75937189-75937211 CTGGAGGAATGGAAAGCTATTGG + Intergenic
1099745216 12:86693124-86693146 CTGAAGGGATTGATAGCTGAAGG + Intronic
1100195902 12:92244071-92244093 CTGAAGAAAATAAAAGCTCATGG - Intergenic
1100894275 12:99161750-99161772 CTGGAGCAATTTATAGCTGACGG + Intronic
1101188344 12:102305445-102305467 AGGGAAAACTTGAAAGCTGATGG + Intergenic
1102332830 12:112049612-112049634 CTGGAGAAATTAAAGACGGACGG + Intronic
1102562031 12:113769225-113769247 GAGGAGAAAATGAAAGCAGACGG + Intergenic
1102721061 12:115016617-115016639 ATGGAGAAACTGAGACCTGAGGG + Intergenic
1102885317 12:116517415-116517437 CTGCAGAACTTCAAAGCTGAAGG - Intergenic
1103285347 12:119796415-119796437 TTGGAGAAATTGGCAACTGATGG + Intronic
1104129659 12:125881104-125881126 CTGGAGTAGTTAAGAGCTGATGG + Intergenic
1104875365 12:132030015-132030037 CTTCAGAAATTGAAATCTGAAGG + Exonic
1105783404 13:23724143-23724165 CTGAAGACCTGGAAAGCTGAGGG + Intergenic
1106921371 13:34567587-34567609 CAGGAGAGAATAAAAGCTGAAGG + Intergenic
1108493093 13:51000500-51000522 CTGGAGAACTTGAGTGGTGAGGG - Intergenic
1108775317 13:53758626-53758648 GTGGAGAAAATGAAGGCTCATGG + Intergenic
1110060245 13:71031187-71031209 CAGGAGAGAATAAAAGCTGAAGG - Intergenic
1110080943 13:71310382-71310404 CTGGAGAAATGGTAATTTGAAGG - Intergenic
1110579181 13:77098749-77098771 TTGCAGACATTGAAATCTGATGG - Exonic
1110867735 13:80416543-80416565 CTAGAGCAATTGAAAGCCTATGG - Intergenic
1110958001 13:81581050-81581072 CTGTAGTAATTGAAAGGTGAAGG + Intergenic
1111006165 13:82252154-82252176 CTTGGGAGATTGAAAGATGATGG - Intergenic
1111048104 13:82842658-82842680 CAGGAGGAATAGAAAGCTGTAGG + Intergenic
1111357166 13:87123145-87123167 CATGAGAAATTGAAGGCTAAAGG - Intergenic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112799616 13:103096169-103096191 CTGGAGAAACTAAAATGTGAGGG - Intergenic
1115141725 14:30179463-30179485 CCTGAGAAATTGGAGGCTGAAGG + Intronic
1115369848 14:32600965-32600987 CTGGAAAACTTGGAAGTTGAAGG - Intronic
1115486311 14:33914431-33914453 CTTGAGAATTGGAAAACTGAAGG + Intergenic
1115621463 14:35144572-35144594 ATGAAGAAAATGAAAGCTCATGG + Intronic
1115863072 14:37711437-37711459 GTGGAGGAATTGAGATCTGAAGG + Intronic
1115923251 14:38401948-38401970 CTTGAGAGAATGAAAGCTCATGG + Intergenic
1117281592 14:54246607-54246629 CTGCAGAATTTGTAAACTGAAGG - Intergenic
1118664334 14:68050355-68050377 CAGGAGAAAATGAAAGATGATGG - Intronic
1118897320 14:69955922-69955944 CTGGAGAAAGAAAAAGCCGATGG - Intronic
1119172513 14:72545858-72545880 CTGCAGAACTGGCAAGCTGAAGG - Intronic
1119332128 14:73802701-73802723 CTGGAGCAAGTCAAAGGTGAGGG + Intergenic
1119836168 14:77750961-77750983 CAGGATAAATTAAAAGTTGATGG + Intronic
1120292925 14:82600216-82600238 CTGGGGACATTAGAAGCTGAAGG - Intergenic
1121226622 14:92325911-92325933 GTGGAGAAATAGAAAGTTGATGG + Exonic
1121802256 14:96784528-96784550 CTAGAGCAATTGGAAACTGAGGG - Intergenic
1121901030 14:97693672-97693694 CTGGAGATATCGAAAGGTGTTGG + Intergenic
1122321559 14:100858790-100858812 CTTGAGAACTTGGAAGCAGAGGG + Intergenic
1122552858 14:102559441-102559463 GTGTAGGAATTTAAAGCTGAAGG - Intergenic
1122680936 14:103462223-103462245 CTGGAGAAATTCATGGGTGAGGG - Intronic
1123127940 14:105962789-105962811 TTGGAGAACTTGAAAGGAGAAGG + Intergenic
1123408457 15:20038932-20038954 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123517781 15:21045573-21045595 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1126433542 15:48612295-48612317 ATGGGGAAATTTAGAGCTGAAGG - Intronic
1126576591 15:50203274-50203296 CTGCAGAAGTTTAAAGCTGATGG - Intronic
1126653410 15:50950271-50950293 TTTGAAAAATTGACAGCTGAAGG - Intronic
1126834516 15:52646208-52646230 CTGGAGAAATAAAAAGTGGACGG + Intronic
1129106081 15:73308230-73308252 AGGGAGAAATTGTAAACTGATGG - Intergenic
1129158782 15:73735286-73735308 CTGGGGAAAGTCAAAACTGAAGG - Intergenic
1129176803 15:73846159-73846181 CTGGAGAAATTCTTAGCTCATGG + Intergenic
1130427845 15:83819416-83819438 CTGGAAAAATTGAAAGCATTTGG + Intronic
1131327208 15:91459487-91459509 CTGGGGAAGCTGGAAGCTGAGGG - Intergenic
1135872088 16:26160590-26160612 CAGAGGAAATTGAAAACTGAAGG - Intergenic
1137230223 16:46557731-46557753 CTTGAAAAATTGAAAGAGGAGGG + Intergenic
1138021722 16:53489463-53489485 TTGGAGAAACTGAATGCTAAAGG + Intronic
1139020056 16:62737680-62737702 CTGTAGAAAATTAAAGCAGATGG - Intergenic
1139187008 16:64818639-64818661 CTGGAGAAACTGCAAGGTGAGGG - Intergenic
1140134629 16:72195122-72195144 CTGGAGACATTGACAGCTGGAGG - Intergenic
1140234894 16:73149988-73150010 CTGTAGAAAATGAAAACTTAGGG - Intergenic
1140662926 16:77205163-77205185 TTGGAGAACTTAAAATCTGAGGG + Intronic
1141475130 16:84267816-84267838 CTGGACACATTGAACGCTGAAGG - Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1143431531 17:6891129-6891151 CTGGAGAAACTGCAGTCTGATGG - Intronic
1143439640 17:6959533-6959555 GTGGAGAGATTGAAAGCCAAAGG - Intronic
1144267310 17:13583483-13583505 CTGGAGAATGTAAAAGCTGGTGG - Intronic
1144558894 17:16305610-16305632 CTGGAGAATTTCAAAAGTGATGG + Intronic
1147203840 17:38822729-38822751 CTGGAGATGTGGCAAGCTGATGG + Intronic
1148630224 17:49101634-49101656 CTAGAGAAGTTGGGAGCTGATGG + Intergenic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1149224493 17:54453648-54453670 AAGGGGAAATTGAGAGCTGATGG + Intergenic
1149345776 17:55733638-55733660 CTGGAAACATTGAAAGTTCAGGG + Intergenic
1149573439 17:57694273-57694295 CTAGAGGAATTTAAAGCTGGTGG - Intergenic
1150447629 17:65239560-65239582 CTGCAAAACTTGACAGCTGAGGG + Intergenic
1150977559 17:70105793-70105815 CTAGTGAAATGGAAACCTGAAGG - Intronic
1151409394 17:73911648-73911670 CTGGAGATACTGAATCCTGATGG - Intergenic
1151507864 17:74541293-74541315 CTGGAGAAATGGAAGGGTGCAGG + Exonic
1152096169 17:78272934-78272956 CTGGAGACAGTGGAAGCCGAGGG + Intergenic
1152976691 18:228066-228088 CTGGAGGAAGGGAAGGCTGATGG - Intronic
1153285718 18:3452367-3452389 CTGGAAACAATGAAAGGTGACGG + Exonic
1153389719 18:4541605-4541627 TTGGAAACATAGAAAGCTGAAGG - Intergenic
1154094889 18:11404089-11404111 CTGAAGAAAATGATAGCAGATGG + Intergenic
1155836787 18:30595169-30595191 CTGCAGAAACTGTAAGCTCACGG + Intergenic
1156146054 18:34180311-34180333 ATGGATAAATGCAAAGCTGATGG + Intronic
1157071796 18:44416765-44416787 CTGGAGGAATTGGCAGCTGTGGG + Intergenic
1157087889 18:44600345-44600367 GTGATGAAAGTGAAAGCTGAGGG + Intergenic
1158289943 18:55929182-55929204 ATCAAGAAATAGAAAGCTGATGG + Intergenic
1160350130 18:78171218-78171240 CTGGACACCATGAAAGCTGAAGG + Intergenic
1160624919 18:80197151-80197173 ATGCAGAAATTGAATTCTGACGG + Intronic
1161308205 19:3578679-3578701 CTGGGGAGATTGAAAGCTAAAGG - Exonic
1164509969 19:28889037-28889059 CTGGTGAAATGGGAATCTGATGG + Intergenic
1167845182 19:52157207-52157229 CTGCAGAAATTTCAAACTGAAGG - Exonic
1167861791 19:52290152-52290174 CTGGAGATATTTCAAGGTGAAGG + Exonic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
1168599685 19:57707882-57707904 CTGGAGAAATTCCAAGCCCAGGG - Intronic
925758270 2:7156277-7156299 CTGAAGCAACTGAAATCTGAGGG - Intergenic
925937968 2:8785751-8785773 CTGCACAAATTGAAAAGTGAAGG - Exonic
927280813 2:21304893-21304915 CTGGAGAGATTGATATCTGAAGG + Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
928049568 2:27976495-27976517 CTGGAAAAATGCAAAACTGAAGG + Intronic
928843745 2:35643628-35643650 CTGGAAAGATTGAGAGTTGAAGG + Intergenic
931256056 2:60573844-60573866 TTGGAAAAATTGAAAGCTGGAGG + Intergenic
932115633 2:69044240-69044262 AAGGAGAAATTAAAAGTTGATGG + Intronic
932446584 2:71785559-71785581 CTGGAGAAGGTGACAGCTGGTGG + Intergenic
932876498 2:75457787-75457809 CTGGGGAAATGGGAAGATGAGGG - Intergenic
932977073 2:76615605-76615627 TTTGAAATATTGAAAGCTGAGGG - Intergenic
933120960 2:78537657-78537679 CTGGAGCAATTGAAAAATTATGG + Intergenic
933127426 2:78626690-78626712 CTGGATTAATTGAAAGAAGATGG + Intergenic
933472448 2:82743066-82743088 CTGGAGAAATGGAGAGTTCAAGG - Intergenic
933537787 2:83598314-83598336 CTCAAGCAAATGAAAGCTGAGGG + Intergenic
934613571 2:95757875-95757897 CAGCTGAAATTGCAAGCTGAGGG + Intergenic
934664898 2:96163389-96163411 CTGGAGGAAGCGAAACCTGAGGG - Intergenic
936414842 2:112297081-112297103 CTTGAGAAATTGAAAGTAGCTGG + Intronic
937106044 2:119313699-119313721 CTGGAGAACTAGATAGCTGGTGG - Intronic
938926634 2:136049078-136049100 TTGAAGAAACTGACAGCTGAAGG + Intergenic
939025410 2:137007522-137007544 ATGGAGAAAGTACAAGCTGATGG + Intronic
939043210 2:137217091-137217113 CTGGAGGAATTGTATACTGATGG + Intronic
939350990 2:141037135-141037157 CAGGAAATATTGAAAACTGAGGG + Intronic
940068026 2:149651628-149651650 CAGGAGAGAATAAAAGCTGAAGG - Intergenic
941780717 2:169441591-169441613 CTGGAGAACTAAAAAGATGAAGG + Intergenic
942895965 2:181054851-181054873 CTGGTGATATTTAAAGCTTAGGG + Intronic
943217146 2:185052612-185052634 CTTGAGAAAAAGAAATCTGAAGG + Intergenic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
945299021 2:208198908-208198930 CTGGAGAAATTTAAAGGCTATGG - Intergenic
947177092 2:227378741-227378763 ATGGAGCAATGGAAAGTTGAAGG + Intronic
948758901 2:240178293-240178315 CAGGATGCATTGAAAGCTGAAGG - Intergenic
1168863029 20:1059765-1059787 CTGAAGGACTTGACAGCTGAAGG - Intergenic
1169138889 20:3215291-3215313 CTGGAGAAGTTAAAGCCTGAAGG + Exonic
1170540563 20:17383193-17383215 CAGAAGAAATTAAAAGGTGAAGG - Intronic
1173456831 20:43209563-43209585 ATGGAAAAATAGAAAGCAGATGG + Intergenic
1173629316 20:44498624-44498646 GGGGAGAAATTGACAGGTGAGGG - Exonic
1173806201 20:45926954-45926976 CTGGAGAAATGGAAAGCCTTAGG + Intergenic
1173835059 20:46119398-46119420 CAGGTGAAAGTGAAAGCTGTGGG - Intronic
1173908347 20:46645180-46645202 CAGGAGAAGTTGAAATCGGAAGG - Intronic
1176081668 20:63276523-63276545 CTTGAGAAGATGAAAGCTGGTGG + Exonic
1176929887 21:14796728-14796750 TTGGAGAAATTGTGGGCTGAGGG - Intergenic
1182409469 22:30170975-30170997 GTGGAGAAATTAAAAGGTGGTGG - Intronic
949360268 3:3224250-3224272 CTTGAGAATTGGAGAGCTGATGG - Intergenic
950316556 3:12005906-12005928 ATGGTGAAATTGATAGGTGAAGG + Intronic
950510165 3:13420828-13420850 CTGGAGAAATGGGAATCTTAAGG - Intergenic
951421466 3:22490892-22490914 CAGTAGGAATTGAAAGATGAAGG - Intergenic
952044944 3:29307251-29307273 CTACAGAAATTGTAAGTTGAGGG + Intronic
952570969 3:34715804-34715826 GGGAAGAAATTGAAAGATGAAGG + Intergenic
952722651 3:36549292-36549314 CTGCAGAAATTAAAAGCACAAGG + Intergenic
953201633 3:40783106-40783128 CTAGAGAAATTGGAGTCTGATGG - Intergenic
953544700 3:43855870-43855892 CTAGAGAAAATGGAAGCTGGAGG + Intergenic
953895758 3:46798886-46798908 CTGGAGAACAGGAAAACTGATGG - Intronic
954069324 3:48131319-48131341 CTGGTGTAATGGAAAGGTGAAGG - Intergenic
955064241 3:55520964-55520986 CTGGAGAATTTGAAACATGAAGG + Intronic
955127718 3:56130709-56130731 ATGGAGAAATTGAAATGTGATGG - Intronic
955268872 3:57476919-57476941 CTAAAGAAATTCAAAGCTAAGGG + Intronic
956931191 3:74045191-74045213 CTGGATAAATTGAAAACAGATGG - Intergenic
958913148 3:100017849-100017871 CCTGAGAAATAGAAAGCTGATGG - Intronic
959785933 3:110297083-110297105 CTGGAGGAATTGGAAACTGGTGG + Intergenic
960352280 3:116607773-116607795 CTGGAGAAGTTGAGAGCAGTGGG + Intronic
961055162 3:123781343-123781365 CTGGACAAATGGAATCCTGAGGG + Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
962056056 3:131872877-131872899 CTAGAAAATTTGAAGGCTGAGGG - Intronic
962471246 3:135711202-135711224 CTGGAGGAAGGGAGAGCTGAGGG - Intergenic
962934625 3:140068372-140068394 CTAGAGAAACTGATAGCTGGAGG + Intronic
963403001 3:144825819-144825841 GTGGAGAACTGGAAAGCTGGTGG + Intergenic
963958328 3:151280203-151280225 ATGGAGAAATGGAAAGCTAAAGG + Intronic
964926693 3:161967378-161967400 ATGGAGAAAGTGAAAGTTTATGG + Intergenic
965569955 3:170162395-170162417 CTGGAAAAATTGGGAGCTAAAGG - Intronic
966374255 3:179279535-179279557 CTGGAAAAATTCAGAGGTGAGGG + Intergenic
966465574 3:180227894-180227916 GTGGACACATTGAAAGGTGAGGG - Intergenic
966481633 3:180415771-180415793 CTGGAGAACTTGAAGCCTGTGGG - Intergenic
966756150 3:183373472-183373494 GTGCAGAAATTGAAAGTTGGAGG - Intronic
969486779 4:7476775-7476797 GTGGAGAAAATGGAAGCAGAGGG - Intronic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
970473314 4:16398103-16398125 CTGGAGATTTTGTAAGCTCAGGG - Intergenic
970830503 4:20334148-20334170 CTAGAGAAATTAAATACTGAGGG + Intronic
971211566 4:24622690-24622712 TGGGAGAAATTGCAGGCTGAAGG + Intergenic
971552123 4:27970589-27970611 CTGAAGAAATTGGGAGGTGAGGG - Intergenic
972207010 4:36785908-36785930 CTTCATAAATTGAAAACTGAAGG - Intergenic
973838559 4:54836997-54837019 CTGGAGAAATTGACAGCATAAGG + Intergenic
973882300 4:55285541-55285563 TTGGAGAAATTGCAGGCTGAAGG + Intergenic
973929689 4:55779410-55779432 GTGGAGAAATTGGAATCTGTGGG + Intergenic
974112554 4:57542569-57542591 CTGGAGAACTAGAAAGGTGGTGG + Intergenic
974381988 4:61152942-61152964 ATGGAGAAACTGGAAACTGAGGG + Intergenic
974487003 4:62518318-62518340 CTGGAGAAGTGAGAAGCTGAAGG + Intergenic
975182881 4:71367325-71367347 CTAAAGAAATTGGAAGCTAAAGG + Intronic
975411286 4:74054197-74054219 CTGGAGGAAATGAATGCAGATGG + Intergenic
975663093 4:76706928-76706950 ATGTCGAAATTGAAACCTGAAGG + Intronic
975784887 4:77877376-77877398 CTACAGAAATTTGAAGCTGATGG - Intronic
976456845 4:85257566-85257588 CTAGAGAAATTCAAAGCCTATGG - Intergenic
976817185 4:89162593-89162615 CTGGATGATTTGAAGGCTGAAGG + Intergenic
977090313 4:92666077-92666099 CTGAAGAAAGTGAAAACTAAAGG - Intronic
977632134 4:99254872-99254894 CTGAAGTAATAGGAAGCTGAGGG - Intergenic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978193067 4:105938468-105938490 AGGGAGAAAGTGAAAGGTGATGG + Intronic
982424704 4:155245012-155245034 CTGGAGAAATTGAGTGATGGTGG + Intergenic
982848281 4:160277713-160277735 ATGGATAAATTGAAAGATGTAGG + Intergenic
982862243 4:160467221-160467243 CTGGATAAACTGATATCTGAGGG - Intergenic
983183289 4:164673668-164673690 CTGGAAAAATAGAAAACTAAGGG + Intergenic
983192325 4:164767849-164767871 CAGTAGAAATTGAAAGCTGGGGG - Intergenic
983780463 4:171663780-171663802 CTAGAGAAATTGAAAGCCTCTGG + Intergenic
983903587 4:173162504-173162526 ATGTATAAATTGAAATCTGAAGG + Intergenic
984520906 4:180799667-180799689 CTGGAGAAGATGAAAACTGGAGG + Intergenic
984581768 4:181518113-181518135 CTTGAGAAATTAAATGCTAAAGG - Intergenic
984752297 4:183289540-183289562 CTGGAGGAACTGAAAGCTCAGGG + Exonic
986048160 5:4060844-4060866 TTAGAGAAATGGAAAGATGATGG + Intergenic
986535276 5:8780065-8780087 AAGCAGAAATTGAAAGCTGGTGG - Intergenic
986639621 5:9859322-9859344 CTGCAGAAAGAAAAAGCTGAAGG + Intergenic
987017303 5:13833743-13833765 CAGAAGAAATTGAGGGCTGATGG - Intronic
987196135 5:15528276-15528298 CTGGGGAAAATAAAAGCTAAAGG - Intronic
987308076 5:16657060-16657082 CTGGGGTAATTCAAAGCTAAGGG + Intergenic
987517595 5:18933546-18933568 TTGGAGAAATTGAAGACTGAGGG - Intergenic
987671960 5:21022160-21022182 CTGGAGAAACTGCAGACTGAGGG - Intergenic
987712954 5:21527861-21527883 CTAGAGAAACAGAAAGCTGATGG - Intergenic
987925860 5:24340891-24340913 CTGGAGAAACTTAAAGCCAAAGG - Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989518992 5:42378561-42378583 CTGGAGAAATTGTAAAGTAAAGG - Intergenic
990739964 5:58902497-58902519 CTGGAGCAAATTAAAACTGAAGG + Intergenic
990974115 5:61542423-61542445 GTGGAGAAATAGTTAGCTGAAGG - Intronic
991552505 5:67855876-67855898 CAGGAGAAATTTAAAGGTGTTGG + Intergenic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
993317569 5:86429901-86429923 GAGGAGAAATTGAAACATGAAGG - Intergenic
994685741 5:102949241-102949263 CTGGATAAATTTCAAGCTAAAGG + Intronic
995035704 5:107531840-107531862 CAGCAGAAATTGTAACCTGAAGG - Intronic
995536504 5:113141867-113141889 CTTGAGAAAGTGAAAGCAAATGG - Intronic
996457226 5:123698728-123698750 ATGGAGTAAGTGATAGCTGAGGG - Intergenic
996759462 5:126972660-126972682 CTGCAGAAAATGAAACCTGTTGG - Intronic
998659445 5:144219867-144219889 CAGGAGAAACTGAGAGCAGATGG + Intronic
998736147 5:145143447-145143469 CTGGGGAAAAAGTAAGCTGAAGG - Intergenic
999105419 5:149066584-149066606 ATGGAGAAGTTAAAAGCTGAAGG + Intergenic
1001018999 5:168166903-168166925 CTGGAGACTTTGAAAGCCAAGGG - Intronic
1002782828 6:380116-380138 CTGGAGAAAAGGGAGGCTGAAGG - Intergenic
1003458745 6:6309512-6309534 CTTAAGAAATTGAAAGATGATGG + Intronic
1004101364 6:12615489-12615511 CTGGATACTTTGAAAGGTGAAGG + Intergenic
1004724671 6:18299761-18299783 CTGGAGAAATTGAATCATTAAGG - Intergenic
1004735763 6:18405001-18405023 CTGGAGAATTTGAAAGCTTTGGG - Intronic
1004982104 6:21036568-21036590 CTTGTGAAAATGTAAGCTGATGG - Intronic
1006183156 6:32166082-32166104 CTGGAGAAATTAATAGGAGAGGG + Intronic
1007396295 6:41579612-41579634 CTGAAATAATTGAGAGCTGAAGG + Intronic
1008361797 6:50628227-50628249 CTAGAGTAATTGAAAGCTTGTGG + Intergenic
1008517316 6:52330350-52330372 TTGGAGAAAGTGAAGGGTGAGGG + Intergenic
1009003769 6:57754051-57754073 CTAGAGAAACAGAAAACTGATGG + Intergenic
1009058175 6:58364451-58364473 GAGAAGAAATGGAAAGCTGAGGG + Intergenic
1009232650 6:61082662-61082684 GAGAAGAAATGGAAAGCTGAGGG - Intergenic
1009369985 6:62887441-62887463 CTTGAGAAAGAGACAGCTGATGG + Intergenic
1009572966 6:65413029-65413051 CTGGGGAAATTGAGAAGTGATGG - Intronic
1010118429 6:72342894-72342916 ATGGGGATATTGAAAGCTGAAGG + Intronic
1010510012 6:76706779-76706801 CTGGAGAGAAAGAAAGCTCATGG - Intergenic
1012528621 6:100207371-100207393 CTGTAGAAATTAAGAACTGAAGG + Intergenic
1012573663 6:100763541-100763563 CGGGAGAGAATAAAAGCTGAAGG + Intronic
1013418634 6:109946777-109946799 CTGGAAATACTGAAAGGTGAAGG + Intergenic
1013701724 6:112779132-112779154 GTGAATAAATTGAAAGCTGTTGG - Intergenic
1015127342 6:129769339-129769361 CTTAAGAAATTCAAAGCTGCTGG - Intergenic
1016566328 6:145458917-145458939 CTGGAGAAATTGAACTTTGATGG - Intergenic
1017638434 6:156466348-156466370 CAGGAGAAGTTAAAAGCAGAGGG - Intergenic
1018607958 6:165618453-165618475 CTGGAGAAGAGGAAGGCTGATGG - Intronic
1018811061 6:167298614-167298636 CTGGAGACGTTGCAAGCTCATGG + Intronic
1019345582 7:528629-528651 ATGGAGAGATTGATAGATGATGG + Intergenic
1020507059 7:9004203-9004225 CTTGGGAAATAGAAAGGTGAGGG - Intergenic
1020686874 7:11307222-11307244 CTTGAGAAATTAAAAGGAGAAGG + Intergenic
1021029203 7:15708762-15708784 CATGAGAAATTGAAAGCCAAGGG + Intergenic
1021204917 7:17768576-17768598 ATGGAGAAATACAAAACTGATGG - Intergenic
1021417327 7:20403321-20403343 CTTGAGAGATTGACAGCTGTGGG - Intronic
1021866471 7:24963192-24963214 CAGGATAAAGTGAAATCTGAGGG + Intronic
1023394863 7:39743333-39743355 AGGGAGAAAGTAAAAGCTGAAGG - Intergenic
1023478184 7:40603968-40603990 CTGGGGATAATGAAAGATGAAGG - Intronic
1023771956 7:43565800-43565822 TTGGATAAATTGGAAGCTGCAGG - Exonic
1024502471 7:50125825-50125847 GTGGAGAAAATGAAAGATGTTGG + Intronic
1026034786 7:66823201-66823223 CTGGAGAACCTGTGAGCTGATGG + Intergenic
1026213962 7:68331807-68331829 ATGCAGAAAGAGAAAGCTGAGGG + Intergenic
1027527080 7:79283308-79283330 TTTGAGAAATTGAAATCTGAGGG - Intronic
1027725425 7:81799422-81799444 GTGGAGAAATTGAATGTTGCAGG - Intergenic
1028242399 7:88437267-88437289 CTTGAGAAAGTGAAAGAGGATGG - Intergenic
1028491805 7:91420916-91420938 CTTCAGAAGTTGAAAACTGAGGG + Intergenic
1030238335 7:107291910-107291932 CTGGAGAAGTTTAAACCTAAGGG - Intronic
1030628290 7:111867874-111867896 CTGGAGCAATTGACTTCTGATGG + Intronic
1030737951 7:113072225-113072247 CTGAAGAAATTTTAAACTGAAGG + Intergenic
1031577357 7:123431030-123431052 CTGGAAAACTTGAGAGCAGAAGG + Intergenic
1031693723 7:124822080-124822102 CTGCAGAAAGTGGAAACTGAGGG + Intergenic
1032183984 7:129707328-129707350 CTGGAGAAAATGAAATGAGAAGG - Intronic
1032786042 7:135200388-135200410 CTGGAGAGAGTGAAAGATGCCGG + Intronic
1032925540 7:136599839-136599861 CTTGAGAAATTTGAAGCTTATGG + Intergenic
1036406064 8:8456196-8456218 CTGGTCACTTTGAAAGCTGAGGG + Intergenic
1036602265 8:10272318-10272340 CTGGAGAACAAGAGAGCTGATGG + Intronic
1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG + Intergenic
1036962460 8:13259985-13260007 CAGGAGAAATGAAAAGCAGAAGG + Intronic
1039332458 8:36553492-36553514 CTGTAGAAATGGAAAGTTGCAGG + Intergenic
1040539656 8:48340727-48340749 TTGGACAACTTGAAAACTGAAGG + Intergenic
1040857552 8:51963966-51963988 CTGGAGAAAAAGGAGGCTGAGGG - Intergenic
1041405264 8:57491953-57491975 CTGATGAAATTGTAACCTGATGG + Intergenic
1041954278 8:63540256-63540278 CTGGAGAACCAGAAAACTGATGG + Intergenic
1043651975 8:82607545-82607567 CTGTTGGGATTGAAAGCTGATGG - Intergenic
1043937957 8:86164797-86164819 GTGGTGACATTGAAACCTGAAGG - Intergenic
1044735167 8:95271460-95271482 CTTGAGAAGATGAAATCTGAGGG + Intergenic
1045838706 8:106554135-106554157 CTGGAGAATTTGAAAATAGATGG + Intronic
1045892927 8:107179155-107179177 CTGGAGAAGATGAAATTTGATGG + Intergenic
1046008979 8:108522787-108522809 CTGAAAATATTGACAGCTGAAGG + Intergenic
1046326358 8:112652322-112652344 TGGGGGAAATTGAAACCTGAAGG - Intronic
1046395817 8:113637441-113637463 CTGGAAAAAATTAAAGCTAAAGG + Intergenic
1046428099 8:114082903-114082925 CTGTTGAAATTTAAAGCAGAAGG + Intergenic
1046612237 8:116438732-116438754 CTGGAGACACTGAAAGTTTATGG - Intergenic
1047186081 8:122634650-122634672 GTGTAGAAACTGAAAGCTAAAGG + Intergenic
1047605245 8:126467991-126468013 CTGGAGACATTGAGAGATCAAGG - Intergenic
1048618489 8:136105789-136105811 ATGGAGAAATTGAGAGTTGAAGG + Intergenic
1048892792 8:138962879-138962901 CTGGAGAAATCTATAACTGAAGG - Intergenic
1048996607 8:139798435-139798457 CTGGGGACATTGAAATCAGAAGG + Intronic
1050460045 9:5869832-5869854 CTGGAGAAAGGGAAGGCTCATGG + Intergenic
1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG + Intergenic
1053859577 9:42373388-42373410 CTGCAGATATTGAAAACAGAAGG + Intergenic
1054251613 9:62722806-62722828 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054565724 9:66757323-66757345 CTGCAGATATTGAAAACAGAAGG - Intergenic
1055133336 9:72801080-72801102 TTGGAGAAAATCAAAGCAGAGGG - Intronic
1055467186 9:76577366-76577388 ATGGAAAGATGGAAAGCTGACGG + Intergenic
1056112872 9:83413302-83413324 TTGGAAAAATAGACAGCTGATGG - Intronic
1057336556 9:94160202-94160224 CCTGAGAACTTGAGAGCTGATGG + Intergenic
1057852206 9:98574491-98574513 CTGGAGGATTTGAAGGCTGGGGG - Intronic
1058726292 9:107807920-107807942 CTGGAAAATTTAAAAGATGAAGG + Intergenic
1059154475 9:111977570-111977592 CTGGTGGACTTGAAAGCTCAGGG + Intergenic
1059793430 9:117665135-117665157 CTGGTGAGTTTGAAATCTGAAGG + Intergenic
1060354025 9:122887073-122887095 CTGGGGAAATTTATAGCAGATGG - Intronic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1186255266 X:7711362-7711384 CTGGAGAAAGTGAAACCACATGG + Intergenic
1187412351 X:19062346-19062368 CAGGGGAAACTGAAAGCAGAGGG - Intronic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1189022247 X:37352682-37352704 CTGGAGAAATCGAAAATTGGAGG + Intronic
1189498404 X:41530304-41530326 CTTGAAAAAGAGAAAGCTGAAGG - Intronic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1191664141 X:63681005-63681027 CTGGAGAATGTGAAAGCTGTTGG - Intronic
1191796301 X:65025429-65025451 CTGGAGAATTCAAAATCTGAAGG - Intronic
1192250611 X:69410465-69410487 CCAGAGAAACTGAAATCTGAAGG - Intergenic
1192833002 X:74769724-74769746 CTGGAGTTACTGAAAGATGAGGG + Intronic
1194187703 X:90793594-90793616 GGGGAAAAATTGAGAGCTGATGG + Intergenic
1194897400 X:99461267-99461289 CTGGAGAAATATAAAGTTAAAGG + Intergenic
1194947670 X:100088712-100088734 CTGGATAAATATAAAGCTAATGG + Intergenic
1195778139 X:108430679-108430701 TTGGAAATAATGAAAGCTGATGG + Intronic
1197222093 X:123924069-123924091 GTGGAAAAATTGAAAAATGAAGG - Intergenic
1197861329 X:130974118-130974140 CTGGAGAAGTTCAAACCTAAGGG - Intergenic
1199408247 X:147487767-147487789 CAGAAGAAATTAAAAGATGAAGG - Intergenic
1200534290 Y:4375546-4375568 GGGGAAAAATTGAGAGCTGATGG + Intergenic
1201471296 Y:14338071-14338093 CTGGAGAAATTGAGACCATATGG + Intergenic
1201577747 Y:15478684-15478706 CTGGCGGAGGTGAAAGCTGAGGG + Intergenic
1201610655 Y:15839704-15839726 CTGGAGTGATTGAAAGCAGTGGG - Intergenic