ID: 969926208

View in Genome Browser
Species Human (GRCh38)
Location 4:10587941-10587963
Sequence GAAATTAGCAGTAAATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969926207_969926208 -9 Left 969926207 4:10587927-10587949 CCGGAGGTTCTGCAGAAATTAGC 0: 1
1: 0
2: 0
3: 15
4: 123
Right 969926208 4:10587941-10587963 GAAATTAGCAGTAAATCAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 151
969926206_969926208 3 Left 969926206 4:10587915-10587937 CCTTTCAAGCTGCCGGAGGTTCT 0: 1
1: 0
2: 1
3: 3
4: 78
Right 969926208 4:10587941-10587963 GAAATTAGCAGTAAATCAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 151
969926202_969926208 25 Left 969926202 4:10587893-10587915 CCTTGTGGTTAACAGTTGGCGCC 0: 1
1: 0
2: 0
3: 4
4: 56
Right 969926208 4:10587941-10587963 GAAATTAGCAGTAAATCAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 151
969926201_969926208 26 Left 969926201 4:10587892-10587914 CCCTTGTGGTTAACAGTTGGCGC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 969926208 4:10587941-10587963 GAAATTAGCAGTAAATCAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 151
969926205_969926208 4 Left 969926205 4:10587914-10587936 CCCTTTCAAGCTGCCGGAGGTTC 0: 1
1: 0
2: 1
3: 4
4: 94
Right 969926208 4:10587941-10587963 GAAATTAGCAGTAAATCAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969926208 Original CRISPR GAAATTAGCAGTAAATCAGC TGG Intronic
903314527 1:22491189-22491211 TAAAATAGCAGATAATCAGCAGG - Intronic
905086982 1:35389456-35389478 AAAATTAGTATAAAATCAGCTGG + Intronic
907345573 1:53776114-53776136 AAAAATAGCAATAAATTAGCTGG - Intronic
911341277 1:96641812-96641834 CTAATAAGAAGTAAATCAGCAGG - Intergenic
915609940 1:156983694-156983716 GAAATGAAAAGCAAATCAGCAGG - Intronic
915718523 1:157966377-157966399 GACCTCAGCAGTAAATCAGCAGG - Intergenic
918037888 1:180893454-180893476 GAAAGAAGCAGTAATTCGGCCGG - Intergenic
919324431 1:196088401-196088423 TAATTTACCAGTAAATCAACTGG - Intergenic
920263839 1:204707482-204707504 GAAATTAGCAATAGTGCAGCGGG - Intergenic
923193735 1:231644406-231644428 GAATTTAACAGCAAATGAGCTGG - Intronic
923853923 1:237825765-237825787 GATATTAGCTGTATATCAGATGG - Intronic
924942497 1:248821807-248821829 GAAGTTAGAAGGAAGTCAGCTGG - Intronic
1063818273 10:9802843-9802865 GAACTTAGCAATAAATTAGAAGG + Intergenic
1066275013 10:33860177-33860199 CAAATTAGCAGGACATCAGTTGG + Intergenic
1067120308 10:43466695-43466717 AAAATAATCAGTAAACCAGCTGG - Intronic
1067123087 10:43491428-43491450 GAAACCAGCAGTGAATCAGATGG - Intergenic
1067542118 10:47163067-47163089 GAAAATAGAAGGAAATCATCAGG - Intergenic
1070728641 10:78809428-78809450 GAGATTTGCAGCCAATCAGCTGG + Intergenic
1073122401 10:101130828-101130850 GAAATTTGGAGTAAATCTCCTGG + Exonic
1075024483 10:118974579-118974601 CAAATTAGCACAAACTCAGCCGG + Intergenic
1076073234 10:127510062-127510084 GAAATTAGCATTAAACTAGAAGG + Intergenic
1076447996 10:130531608-130531630 TAAAATAGCAGTAAATAGGCCGG + Intergenic
1076569525 10:131423314-131423336 GAAAATAGCAGTGAATCTGGGGG - Intergenic
1079115632 11:17638934-17638956 GAAAATACAAGAAAATCAGCCGG + Intronic
1079456664 11:20642473-20642495 TGAATTAGCAGAAAAACAGCAGG - Intronic
1079510901 11:21208936-21208958 GAGCTTAGCAGAGAATCAGCAGG + Intronic
1079537292 11:21529463-21529485 GCAAATAGCAGAAAATAAGCAGG + Intronic
1080297510 11:30747370-30747392 GAATTAACCAATAAATCAGCAGG - Intergenic
1080365500 11:31569563-31569585 CAAAATGGCAGTAAATCAGCTGG + Intronic
1081105615 11:39065118-39065140 GAATTTAGCAGTGTATCAGTTGG + Intergenic
1081823413 11:46022764-46022786 GAAACTAACAGTATATGAGCCGG - Intronic
1084078595 11:66802447-66802469 TAAATTAGCAGTATATGGGCTGG - Intronic
1085665214 11:78409206-78409228 GAAATTACCAGAGACTCAGCAGG + Intronic
1085968618 11:81559529-81559551 GAAAGTAGAAGTAAAGAAGCAGG - Intergenic
1092357499 12:7808798-7808820 GAAATTAGGAGTGAATTGGCTGG - Intergenic
1096141024 12:49242627-49242649 AAAATTAGCTGGAAATTAGCTGG - Intronic
1105749754 13:23411961-23411983 GAAATTAAAAGTACATCGGCCGG + Intronic
1106963302 13:35027540-35027562 GAAATCAACAGTAAAGAAGCTGG - Intronic
1107693399 13:42975506-42975528 TAAATAAGCAGGAAATCATCGGG + Intronic
1108783467 13:53866393-53866415 GAAACTGGCAGGAAACCAGCAGG - Intergenic
1112998701 13:105605990-105606012 GAAATTAACAGTACATTAGAAGG - Intergenic
1116105307 14:40495175-40495197 GAGATTAGCACTGAATCAGTAGG + Intergenic
1116471459 14:45290580-45290602 GAGAATAGCAGTAAATTGGCTGG + Intergenic
1117057161 14:51924357-51924379 GAAATTAGTAGTACATCATCAGG + Intronic
1118207754 14:63738905-63738927 GAAAATAACAGAAACTCAGCCGG - Intergenic
1118587204 14:67365796-67365818 GAAAGTATCAGTAAACCAGACGG - Intronic
1118944380 14:70370727-70370749 GAAGTTAAAAGTATATCAGCAGG - Exonic
1119448366 14:74685902-74685924 GAAATTAGCAATAAAGCAAGTGG - Intronic
1120073685 14:80132154-80132176 GAAAAAAACAGTAAATAAGCAGG + Intergenic
1120330602 14:83088698-83088720 AAAATGAGCAGAAATTCAGCAGG - Intergenic
1120496093 14:85237948-85237970 GATATTACTTGTAAATCAGCTGG - Intergenic
1124484469 15:30102819-30102841 GAATTCAGCAGTGAATCATCAGG + Intergenic
1124519114 15:30394405-30394427 GAATTCAGCAGTGAATCATCAGG - Intergenic
1124539542 15:30571816-30571838 GAATTCAGCAGTGAATCATCAGG + Intergenic
1124759109 15:32435756-32435778 GAATTCAGCAGTGAATCATCAGG - Intergenic
1124974425 15:34519865-34519887 GAATTCAGCAGTGAATCATCAGG - Intergenic
1132185958 15:99801896-99801918 GAATTCAGCAGTGAATCATCAGG + Intergenic
1132429719 15:101750802-101750824 GAATTCAGCAGTGAATCATCAGG - Intergenic
1132701496 16:1224107-1224129 GAAATTAAGAGGAAGTCAGCTGG + Intronic
1134370934 16:13623943-13623965 GGTATTAGCAGTAAATCAAGTGG + Intergenic
1137401783 16:48159538-48159560 AAAATTAGCAGGATCTCAGCAGG + Intergenic
1140879469 16:79184795-79184817 GAAATCAGAACTAAATTAGCTGG - Intronic
1142258254 16:89026324-89026346 GAAATGGTCAGTAAATCACCAGG + Intergenic
1147425817 17:40345424-40345446 GAGATCAGCAGGAAATCAGCCGG - Intronic
1156854908 18:41770291-41770313 GAAATCAGCAGTGAAGGAGCTGG + Intergenic
1159664060 18:71135594-71135616 GAATTTAGAATTACATCAGCAGG + Intergenic
1161776887 19:6268391-6268413 GAAATAAGAAGCAAATGAGCTGG + Intronic
1162201718 19:9025309-9025331 GTAAATAGCAGTAAAGGAGCTGG + Intergenic
1165181358 19:33973993-33974015 TCAATTAACAGTAAAACAGCTGG - Intergenic
1166246493 19:41530835-41530857 GAAATAAGCAGAACATCAGCTGG - Intergenic
1166246522 19:41531160-41531182 GAAATAAGCAGAACATCAGCTGG - Intergenic
1168580901 19:57554956-57554978 GAATTTAGGAATAAATAAGCAGG - Intronic
926872981 2:17443744-17443766 AAAATTAGCAGTAAATTAAAAGG + Intergenic
927690651 2:25205735-25205757 GAAATCTGCATTAGATCAGCAGG - Intergenic
932016122 2:68028676-68028698 GAAATTAGCAGTATCTGAGATGG + Intergenic
933220065 2:79678183-79678205 AAAATTAGGAGTCGATCAGCTGG - Intronic
936828074 2:116605587-116605609 GCAATGAGGGGTAAATCAGCAGG - Intergenic
938880804 2:135585094-135585116 GAAATTTTAGGTAAATCAGCGGG + Intronic
941201045 2:162511324-162511346 ACAATTAGCAGTAAATTAGTAGG - Intronic
943112939 2:183628757-183628779 GAAATCAGCAGTAAGGCAGGTGG - Intergenic
945376989 2:209089624-209089646 GAAATTTGCAGCAACTCAGGAGG - Intergenic
946267692 2:218561861-218561883 GAAATTATAAGTAATTCAGAAGG - Intronic
1169284902 20:4299915-4299937 CTAATTACCAGTTAATCAGCTGG + Intergenic
1179305679 21:40152034-40152056 GAGATTTGCTGTAAATCTGCAGG - Intronic
1179774864 21:43655292-43655314 GAAATTAGAAGTCAATGACCTGG + Intronic
1182294566 22:29305480-29305502 GAAATCAACAGCAAAACAGCAGG - Intergenic
956294937 3:67702209-67702231 GAAATTATCAGTAGACCAGAAGG + Intergenic
956601158 3:71024040-71024062 GAAATCAGCTGGAAATCAGCTGG + Intronic
957294333 3:78317309-78317331 GAAATTAACAGAAAATTAGGTGG - Intergenic
961384076 3:126514976-126514998 GAAAATAGAAGTCAAGCAGCAGG + Intronic
963368045 3:144363799-144363821 AAAATTAGCTGGAAATTAGCAGG - Intergenic
963389258 3:144636939-144636961 GAACAGAGCAGTAAACCAGCTGG - Intergenic
963491552 3:146008264-146008286 AAAATTATAAGTAAATCGGCCGG + Intergenic
963514809 3:146294753-146294775 GAATTCAGCAGTGAATCAGTTGG + Intergenic
964090921 3:152874435-152874457 GAAATTTGCAGTAAATAACAAGG - Intergenic
965540415 3:169865947-169865969 GGAATTATAAGTAAATCAGAGGG + Intronic
965922982 3:173942029-173942051 GAACTTAGCAGTAAATAAGAAGG - Intronic
967434280 3:189426439-189426461 GAAAATAGTAGTGAACCAGCCGG - Intergenic
967487753 3:190054022-190054044 TACATTAGTAGAAAATCAGCTGG + Intronic
967989212 3:195118919-195118941 GTCATTAGCTGTACATCAGCAGG + Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969926208 4:10587941-10587963 GAAATTAGCAGTAAATCAGCTGG + Intronic
970504721 4:16716163-16716185 GAAATTTGCTGTACATCAGAAGG - Intronic
970759223 4:19463900-19463922 GAAAATAGTAGTAAAGCAGTAGG - Intergenic
971750157 4:30636617-30636639 GAAATTAGCCTTATATCTGCAGG + Intergenic
973942589 4:55925641-55925663 GCAGTTAGCAGTAAAGAAGCCGG - Intergenic
976209767 4:82655949-82655971 CAAATCAGCAGAACATCAGCTGG + Intronic
980156672 4:129115932-129115954 GAAATTATCAGAAAATGAGTAGG - Exonic
982391574 4:154869992-154870014 GAAATGAACAGTATCTCAGCAGG - Intergenic
983700153 4:170581845-170581867 CAACTAAGCAGAAAATCAGCAGG + Intergenic
984243818 4:177250317-177250339 GAGATTGGCAGGAACTCAGCGGG - Intergenic
986345777 5:6833854-6833876 GAAATAAGCAGCACATCAGATGG + Intergenic
986860374 5:11920427-11920449 GGAATGAACAGTCAATCAGCCGG - Intergenic
987496295 5:18649152-18649174 GAATTCAGCAGTAAAGCATCTGG + Intergenic
988250562 5:28751874-28751896 GAAATTAGGAGAAAACCTGCTGG + Intergenic
989542739 5:42636495-42636517 GAATTAAGCAGCAAATCAGTGGG - Intronic
990718513 5:58666678-58666700 GAAGTTAGGTGGAAATCAGCTGG + Intronic
994113184 5:96031849-96031871 GAATTTGGGAGTAGATCAGCTGG + Intergenic
995227036 5:109712067-109712089 AAAATTAGCAGCAAATCACTGGG - Intronic
996471549 5:123867120-123867142 GAACTTAGCAGTCAGTCTGCTGG + Intergenic
1001622360 5:173098414-173098436 GAAATCAGAAGGAAATCAGAAGG - Intronic
1002803000 6:544137-544159 GAAATAAGGAGTAAAACAGCTGG - Intronic
1007980118 6:46145233-46145255 GAAATTAGCAGTGACTCAATAGG - Exonic
1009927231 6:70134841-70134863 GGAATTAGAAGACAATCAGCTGG - Intronic
1010933290 6:81829721-81829743 AAAATTAGCAGTATATGGGCCGG - Intergenic
1011049576 6:83129755-83129777 AAAAGTAGCAGTAGATCTGCTGG + Intronic
1011344378 6:86352905-86352927 GAAATAAGAAGTAAGTGAGCTGG - Intergenic
1012517586 6:100080670-100080692 GAAATTAGCAGTAGAGAAGATGG + Intergenic
1013617643 6:111859706-111859728 GAAAGTAGCAGTCACTCAGAGGG - Intronic
1014725923 6:124971748-124971770 AAACTTAACAGTAAATCGGCCGG - Intronic
1016610549 6:145984164-145984186 GAAATAAGGAGTACATCAGCAGG + Intergenic
1017088914 6:150741173-150741195 GTCATTAGCAATCAATCAGCAGG - Intronic
1017609428 6:156169006-156169028 GAATTTAGCATTAAACCAGTTGG - Intergenic
1018348740 6:162932486-162932508 GAATTTAGCAGTGAAGCAACTGG + Intronic
1018523160 6:164675937-164675959 AAAATGAGCAGAGAATCAGCAGG - Intergenic
1020016717 7:4835728-4835750 GAAATGAGCAGCAAAGGAGCTGG + Intronic
1020712728 7:11629123-11629145 GAAAGCAGCAGTATATCAGATGG - Intronic
1021034165 7:15776039-15776061 GAAATAAGAAGTAAATTTGCAGG - Intergenic
1025972368 7:66339390-66339412 GAATTTAGCAGTGAAGCAACAGG - Intronic
1029200619 7:98836887-98836909 GAAATAAGCAGAAAATAAGCTGG - Intergenic
1030433726 7:109487937-109487959 GAAATGAGCAGCATATCAGGTGG + Intergenic
1031348471 7:120698982-120699004 GAAAATGGTATTAAATCAGCCGG + Intronic
1031448583 7:121885561-121885583 GAAGTTAGGAGAAAATAAGCTGG - Intronic
1032141468 7:129335079-129335101 GAAAAGAGAAGTAAAGCAGCAGG + Intronic
1035214293 7:157353464-157353486 GACATTAGCAGAAAAACAGGTGG - Intronic
1038470554 8:27814159-27814181 GAAATCAACAGTAAAACATCTGG + Intronic
1039002009 8:32991780-32991802 GAAATCAGCAGTGAATCAACTGG + Intergenic
1040040469 8:42911603-42911625 GAAATTTGTAGTAATTCAGAAGG + Intronic
1040475787 8:47776111-47776133 AGAAATAGGAGTAAATCAGCTGG - Intronic
1041165523 8:55088850-55088872 AGAATTAGCAGGAATTCAGCAGG - Intergenic
1043168937 8:76939648-76939670 GAAATTTTCATTAACTCAGCAGG + Intergenic
1043486241 8:80701789-80701811 GAAATTAGCAGCAAGGAAGCAGG + Intronic
1044078603 8:87855833-87855855 TAAATTAGCAGTAAGCCAGAAGG + Intergenic
1045224780 8:100233847-100233869 GAAACTAGCAGTAATGCTGCTGG + Intronic
1045971137 8:108081656-108081678 GAAATACGCACTAAATCTGCAGG + Intronic
1051235550 9:14994682-14994704 GAAATCAGCTGGAAATCAGTAGG + Intergenic
1052496877 9:29238380-29238402 GAAATTAGAAGTAGATCAAAGGG - Intergenic
1055231731 9:74074542-74074564 GAAATTAGGAGTCATGCAGCTGG - Intergenic
1060951665 9:127607905-127607927 GAATCTAGCAGCAAATAAGCGGG + Intergenic
1188670435 X:32875487-32875509 GAAATTAGAAGTAGATAAACTGG - Intronic
1194571039 X:95554838-95554860 CAACTTGGCAGTAAATTAGCTGG - Intergenic
1194740129 X:97562556-97562578 GAAATTAGGAGTAAGTCACATGG - Intronic
1195302670 X:103546283-103546305 AAAATTAGCAGTGAACCATCAGG - Intergenic
1197498271 X:127212693-127212715 TAAACTAGCAGGATATCAGCAGG + Intergenic