ID: 969926956

View in Genome Browser
Species Human (GRCh38)
Location 4:10594105-10594127
Sequence CTGGTGGGAAGCAGAAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 406}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969926956_969926962 1 Left 969926956 4:10594105-10594127 CCCACTCTTCTGCTTCCCACCAG 0: 1
1: 0
2: 3
3: 25
4: 406
Right 969926962 4:10594129-10594151 TACTGAGCATGCAGGTATCCAGG 0: 1
1: 0
2: 0
3: 10
4: 99
969926956_969926960 -7 Left 969926956 4:10594105-10594127 CCCACTCTTCTGCTTCCCACCAG 0: 1
1: 0
2: 3
3: 25
4: 406
Right 969926960 4:10594121-10594143 CCACCAGATACTGAGCATGCAGG 0: 1
1: 0
2: 3
3: 47
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969926956 Original CRISPR CTGGTGGGAAGCAGAAGAGT GGG (reversed) Intronic
900471502 1:2857211-2857233 CTGGAGGGAAGCAGCGGAGGAGG - Intergenic
900931698 1:5742074-5742096 CAGGTGGGAAGGTGAGGAGTGGG - Intergenic
901203585 1:7481093-7481115 GGGTTGGGAAGCAGAAGAGAGGG - Intronic
902306680 1:15545642-15545664 CTGGTGAGCAGCAGAGGAGGGGG + Intronic
902328543 1:15718649-15718671 CTTGTGGGAAGCAGAGGAGGGGG + Intronic
902360323 1:15938942-15938964 CTAGTGGGCACCAGATGAGTAGG - Intronic
903419815 1:23210601-23210623 CTGGTGGGAGTCTGAAGACTTGG - Intergenic
903943945 1:26950228-26950250 CTGCTGAGAAGGAGCAGAGTGGG + Intronic
904311806 1:29633974-29633996 CTGGAGGGAAGCAGATGGGGAGG + Intergenic
904743932 1:32699496-32699518 ATAGTGGGATGCAGAAGAGGGGG - Intronic
904839038 1:33358986-33359008 CAGCTGGTAAGCAGCAGAGTTGG - Intronic
905128779 1:35735828-35735850 GTGGTTGGAAGAGGAAGAGTAGG - Intronic
905319725 1:37107309-37107331 CTGGGAGGAAGCAAAACAGTGGG + Intergenic
905780544 1:40705276-40705298 GGGGTGGGGAGCAGAAGAATAGG - Intronic
906127193 1:43434192-43434214 CTGGTGGGAAATGGAAGAGACGG - Intronic
906685456 1:47760422-47760444 CTGCAGTGAAGCAGAGGAGTTGG - Intergenic
906746523 1:48225925-48225947 GTGGTGAGAAGGAGAAGGGTGGG - Intronic
907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG + Intergenic
907949659 1:59170055-59170077 CTGGTGGTATGCAGGAGAGGTGG - Intergenic
908261063 1:62339496-62339518 CTGCTGGGAAGGTGATGAGTGGG + Intergenic
908531711 1:65040405-65040427 CAAGTGGGAAGCAGGAGAGTCGG - Intergenic
909229886 1:73073679-73073701 CTGATGGATAGCAGAACAGTTGG - Intergenic
909489058 1:76206367-76206389 CAAGTGGAAAGCAGCAGAGTTGG - Intronic
910159846 1:84261033-84261055 CTGGTGAAAAGTAGTAGAGTAGG + Intergenic
910501226 1:87893527-87893549 GTGTTGGGAAGCAGCAGAGTAGG + Intergenic
912759951 1:112357892-112357914 CAGGGGGGAGGCAGAAGATTTGG + Intergenic
912811613 1:112799315-112799337 CTGCTGGGAAGCAGCAGTGAAGG - Intergenic
913162497 1:116156918-116156940 TTGGTGGGATTCAGAGGAGTAGG + Intergenic
913283548 1:117207947-117207969 CTGGAGGCCAGAAGAAGAGTTGG - Intronic
913290283 1:117265578-117265600 CTGATGGGTAGCAGAAGATAGGG - Intergenic
913531030 1:119734611-119734633 CTGGTTGGAAGCAAGAGAGAGGG - Intronic
915129280 1:153685973-153685995 CTGGTGGGGAGCAGCAGATGGGG + Intronic
915554708 1:156654974-156654996 CTGGTGGGAATCAGTAGGGGTGG - Intronic
915597835 1:156905482-156905504 CGGGAGGGACTCAGAAGAGTAGG - Intronic
916107083 1:161440529-161440551 CCGGTGGGAAGCGTAGGAGTGGG - Intergenic
916108651 1:161447943-161447965 CCGGTGGGAGGCGGAGGAGTGGG - Intergenic
916110239 1:161455324-161455346 CCGGTGGGAGGCGGAGGAGTGGG - Intergenic
916111824 1:161462734-161462756 CCGGTGGGAGGCGGAGGAGTGGG - Intergenic
916113411 1:161470115-161470137 CCGGTGGGAGGCGGAGGAGTGGG - Intergenic
917213561 1:172655533-172655555 CTGGAGGATAGCAGGAGAGTTGG + Intergenic
919475235 1:198024631-198024653 CTGGTGGAAAGAAGAAGGGAAGG - Intergenic
919568487 1:199218668-199218690 CTGGTGGGAAACTGCAGTGTGGG + Intergenic
919779405 1:201212634-201212656 CTTTTGGGAGGCAGAAGGGTAGG + Exonic
919786616 1:201262193-201262215 CAGGTGGGGAGCAGAGGACTGGG + Intergenic
919885904 1:201934587-201934609 CTAATGGGAAGCAGAATAGTAGG - Intronic
920241352 1:204553391-204553413 CAGGTGGGATGCAGAAAAATGGG - Exonic
920602072 1:207337037-207337059 CTGGTGGGTTTCTGAAGAGTTGG - Intronic
922718420 1:227888413-227888435 CTGTTGGGTAGGAGAAGGGTCGG + Intergenic
923124412 1:231022808-231022830 CTGGTGGGCTGCTGAAAAGTAGG - Intronic
924090493 1:240496275-240496297 CTGGTGAGATGCAGGGGAGTGGG - Intronic
924125580 1:240847113-240847135 CTTTTGGGGATCAGAAGAGTTGG - Intronic
924314421 1:242781284-242781306 CTGGTGGGAACCAACAGATTTGG + Intergenic
1064723030 10:18249200-18249222 CAGGAAGGAAGCAGAAGATTTGG - Intronic
1066435365 10:35392642-35392664 CTGGTTGAAAGCAGAGGAGAGGG + Intronic
1066716246 10:38289519-38289541 CTAGTAGTAAGCAGAAAAGTGGG + Intergenic
1066874683 10:40582951-40582973 TTGGTGGGAAGAAGAAGGGAGGG - Intergenic
1068094418 10:52472540-52472562 ATGGTGGGTGGCAGAACAGTTGG + Intergenic
1068820807 10:61376394-61376416 CTGTTGGGAAGCACCAGTGTTGG + Intergenic
1068916820 10:62441883-62441905 CAGGTGGGAGGCAGAATAGATGG + Intronic
1069776791 10:70932028-70932050 CTGGAAGGAGGAAGAAGAGTGGG + Intergenic
1069842319 10:71347528-71347550 CTGGGTGGAAGCAGCAGAGAGGG + Intronic
1069919561 10:71808189-71808211 CTGGTGGGTAGATGAAGAGGTGG - Intronic
1070078483 10:73161994-73162016 GGGGTGGGGAGAAGAAGAGTTGG - Intronic
1072766279 10:98097415-98097437 CTGGTGGGACGCAGGACAGAAGG - Intergenic
1073278737 10:102335564-102335586 CTTGTAGGAAGCAGTAAAGTCGG + Intronic
1073323489 10:102629514-102629536 CTTGGTGGGAGCAGAAGAGTGGG - Intronic
1073814879 10:107195735-107195757 ATGGTGGGAATTAGAAGAATAGG - Intergenic
1074158184 10:110816254-110816276 GTGGTGGGAGGGAGAAGAGCAGG - Intronic
1074284270 10:112083237-112083259 TTTCTGGGCAGCAGAAGAGTAGG - Intergenic
1074683333 10:115933477-115933499 CTTGTGGGCGGCAGCAGAGTGGG - Intronic
1075434742 10:122428116-122428138 CTGTTGGGAAGAGGAAAAGTTGG + Intronic
1076454345 10:130579044-130579066 CTGGAGGGAAGCAGGAAAGAGGG - Intergenic
1077537188 11:3130018-3130040 CTGGTGGGGAGCAGGACAGAGGG - Intronic
1077928729 11:6708581-6708603 GTGGGGGAAAGCAGAAGTGTAGG - Intergenic
1078552151 11:12288352-12288374 CTGGTGGCACACAGTAGAGTGGG - Intronic
1079147031 11:17862094-17862116 CTGGAGGGGAGCAGAGCAGTGGG - Intronic
1081611592 11:44566241-44566263 TTGGTGGGAAGCAGGTGAGGCGG - Intronic
1082764586 11:57156845-57156867 TAGGAGGGAAGCAGAGGAGTGGG + Intergenic
1082988702 11:59189060-59189082 CTGCTGGAAAGGAGGAGAGTAGG + Intronic
1083888380 11:65583789-65583811 TTAGTGGGAAGCAGCAGACTGGG - Intronic
1083926723 11:65811805-65811827 CTCATGGGTAGCAGAGGAGTTGG - Intergenic
1084349581 11:68586403-68586425 CTGGCTGAAAGCAGAAGGGTAGG - Intronic
1084944495 11:72631435-72631457 CTGGAGAGAAGCAGAAGTGGAGG - Intronic
1084970883 11:72771492-72771514 CTTTTGGGAAGAAGATGAGTTGG - Intronic
1085051922 11:73384334-73384356 CTGGTGGGAATCTGGAGGGTGGG - Intronic
1085799389 11:79574784-79574806 CAGCTGGCAAGCAGAAGAGCAGG - Intergenic
1086160908 11:83720807-83720829 CTGGTGAGCAGCAGAAGAGAGGG - Intronic
1086897673 11:92332548-92332570 CTAGTGATAAGCAGAAGAGAGGG + Intergenic
1087686679 11:101273153-101273175 CTGGCAGCAAGCAGAAGAGGTGG - Intergenic
1087997588 11:104829424-104829446 CTGGTGGGAAGGAAGAGAGGAGG + Intergenic
1091168814 11:133502746-133502768 CTCCTGAGAAGCAGAATAGTGGG - Intronic
1091264281 11:134258395-134258417 GTGGAGTAAAGCAGAAGAGTGGG - Intronic
1091834696 12:3577222-3577244 CTGGTGGCGTGCAGAAGGGTGGG + Intronic
1092184005 12:6465092-6465114 CCCCTGGGAAGCAGAAGGGTAGG - Intronic
1093569971 12:20655530-20655552 CTAGTGATAAGCAGAACAGTGGG - Intronic
1093630775 12:21406709-21406731 CAGCTGGTAAGCAGAAGAATGGG + Intronic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1096197641 12:49658851-49658873 CTAGTGGGGAGCAGAGGAGTTGG - Intronic
1096242596 12:49967323-49967345 CGGGTGGGGCGCAGAAGAGAGGG + Intronic
1097649276 12:62275797-62275819 CAGGTGTGATGCAGTAGAGTTGG + Intronic
1097856939 12:64473362-64473384 GTGGTGGGAAGCAGAGAATTGGG + Intronic
1098691064 12:73488690-73488712 CTGGGGTGAACCAGAGGAGTAGG - Intergenic
1098880038 12:75907731-75907753 ATGGTGGAAAGCAGAAGGGTAGG - Intergenic
1099206797 12:79737782-79737804 CTGGTGGGAAGCAGAGCAAAAGG + Intergenic
1101072223 12:101087720-101087742 CTGGAGGGAAGATGAGGAGTTGG - Intronic
1101891018 12:108715501-108715523 CTGGTGATAAGCAGAAAATTGGG - Intronic
1102330888 12:112029248-112029270 GTGATGGGAAGAAGAAAAGTAGG + Exonic
1102409899 12:112708547-112708569 CTGGTGGGGAGCAAAGCAGTGGG + Intronic
1102542806 12:113634819-113634841 CTGGGGGTGAGCAGAAGGGTGGG - Intergenic
1102713785 12:114952478-114952500 CTGGTGGGAAAGAGAGGTGTGGG - Intergenic
1102757624 12:115355941-115355963 CAAGTGGGAAGCAGTAGAGATGG - Intergenic
1102986164 12:117280376-117280398 CTGGTGAGAGGCAGGAGATTTGG + Intronic
1103738999 12:123078680-123078702 CATGTGGGAAGCAGAGGAGAAGG + Intronic
1104438715 12:128777825-128777847 CATGTGGGAAGCAGGAGAGCAGG - Intergenic
1106032870 13:26018313-26018335 CTCGTGGGATGGAGAAGAGGAGG - Intronic
1106923541 13:34589691-34589713 AGGGTGGGAAGCAGAAGGGAGGG + Intergenic
1107109219 13:36677568-36677590 CTGATGGGAAGCAGAAGGATAGG + Intronic
1107302583 13:38981124-38981146 CTGGTTGCAAGATGAAGAGTTGG - Intronic
1107416496 13:40206086-40206108 CTGGTGGGAATGAGAGGAATTGG + Intergenic
1108098467 13:46929601-46929623 CTGCTGTGAAGCAGAAGGGGAGG + Intergenic
1108693955 13:52886289-52886311 CTGGTGTGAAACAGAAGTTTGGG + Intergenic
1109255209 13:60071948-60071970 CTGATGGGAAGCAGAATTGGGGG - Intronic
1109491775 13:63110582-63110604 CTGATAGAAAGCAGATGAGTTGG - Intergenic
1110863798 13:80372710-80372732 CAGGTAGCAAGCAGCAGAGTTGG + Intergenic
1112985637 13:105446038-105446060 CTTGTGGGGAGCAGAGGAGATGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114242509 14:20881504-20881526 TGAGTGGGAAGGAGAAGAGTAGG + Intergenic
1114586992 14:23824596-23824618 CTGAAGGGAAGCAAAACAGTTGG + Intergenic
1115403986 14:32995367-32995389 ATGGTGGGAATCAGAGAAGTAGG - Intronic
1116804581 14:49480311-49480333 CTGGAGGTAAGCAGTACAGTTGG - Intergenic
1118479706 14:66152195-66152217 GAGGTGGGAAACAGAAGAGCTGG + Intergenic
1118616107 14:67575497-67575519 TTCGGGGGAAGCAGGAGAGTGGG - Intronic
1119162468 14:72464415-72464437 CCGGGTGGAAGCAGAAGTGTGGG + Intronic
1121337421 14:93085889-93085911 ATTGTGGGAAGCAGGGGAGTTGG + Intronic
1121526862 14:94625255-94625277 CTGGTGGGCTGCAGAAGGGCTGG + Intergenic
1122383630 14:101328930-101328952 GTGGTGGGGAGCAGGGGAGTGGG + Intergenic
1122685307 14:103501685-103501707 CTAGAGGGCAGCAGAAGAGGTGG - Intronic
1122906997 14:104806168-104806190 CAAGTGGGAAGCAGGTGAGTCGG + Intergenic
1123021677 14:105400693-105400715 AGGCTGGGAGGCAGAAGAGTGGG + Intronic
1123686643 15:22802726-22802748 CAGATGGGCATCAGAAGAGTAGG - Intronic
1125343180 15:38694443-38694465 CTGGTGGGCTGGAGTAGAGTAGG + Intergenic
1125584232 15:40808987-40809009 CTGGGAGGAAGAAGAGGAGTGGG - Intronic
1125774730 15:42202046-42202068 CATGTGGCAAGCAGCAGAGTTGG + Intronic
1127650700 15:61003853-61003875 CTGGTGGGAAGCAGATGGGAAGG + Intronic
1128350908 15:66887784-66887806 CAGGTGGGCAGCAGGAGACTCGG - Intergenic
1128756122 15:70185212-70185234 GTGGTGGGAAGGAGAGGAGGAGG + Intergenic
1129142295 15:73610754-73610776 CTGGAGGGGACCAGAAGGGTAGG - Intronic
1129244083 15:74269305-74269327 CTGGTGGGAAGTAGGGGGGTGGG - Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1131060017 15:89398905-89398927 CAGCTGGGAAGCAGTGGAGTCGG + Intergenic
1131827292 15:96331603-96331625 CTGGTGTGCAGCCGAGGAGTTGG - Exonic
1132359441 15:101200655-101200677 CTTGCGGGCTGCAGAAGAGTGGG - Intronic
1132767170 16:1540208-1540230 CAGGTGGGAAGCAGATGCCTCGG + Intronic
1134505766 16:14805611-14805633 CTGGTGGAAACCTGAGGAGTCGG - Intronic
1135294807 16:21269982-21270004 CTTGAGGGAGGCAGAAGAGAGGG - Intronic
1135340940 16:21647495-21647517 GTGGGAGGAAGCAGATGAGTGGG + Intronic
1135728687 16:24876686-24876708 CTGGTGGGAAGCTGCAGATGTGG + Intronic
1136134732 16:28248628-28248650 CTGGTTGGAAGAAGAAGTGCTGG - Intergenic
1137583278 16:49647547-49647569 CAGGAGGGAGGCAGAAGAGGAGG + Intronic
1137746338 16:50822965-50822987 CTGGCGGAAAGGAGAAGAATGGG + Intergenic
1137882582 16:52067407-52067429 ATGGTGGGATGCAGAGTAGTAGG - Intronic
1138615872 16:58165993-58166015 TGGGTGGCATGCAGAAGAGTGGG + Intronic
1139008795 16:62607223-62607245 GGGGAGGGAAGCAGAAGAGAGGG - Intergenic
1139350540 16:66332347-66332369 CTGGTGGGTTGCTGCAGAGTTGG + Intergenic
1139438485 16:66950510-66950532 CTGGTGGGAATAAGAACAGCAGG + Intergenic
1139489272 16:67278065-67278087 CTGGTGGGCAGCAGAAGGGGAGG + Exonic
1140329542 16:74040591-74040613 CTGGTGGGAAGAAGAAAGGAGGG + Intergenic
1141858159 16:86698972-86698994 CTGATGGGAAGCAGATCAGGAGG + Intergenic
1141984808 16:87572808-87572830 TGGGTGGGAACCAGAAGCGTTGG - Intergenic
1142398793 16:89848388-89848410 CTGGTGGGAAGTATATCAGTGGG - Intronic
1142686154 17:1578050-1578072 CTCGTGGGAAGCAGGTCAGTGGG - Intronic
1143387005 17:6536923-6536945 CTGCTGGGCTGCAGAGGAGTTGG - Intronic
1146255932 17:31391634-31391656 GGGGAGGGAAGGAGAAGAGTGGG - Exonic
1147914585 17:43878896-43878918 CTGGGGGAAAGCTGAAGGGTAGG - Intronic
1148586994 17:48788000-48788022 CTGTTGGGAAGCAGAACATGGGG + Intronic
1148910297 17:50938953-50938975 CTGGTGGGAAGCAGGTGGCTTGG - Intergenic
1149899475 17:60460692-60460714 CTGGTGGACATAAGAAGAGTAGG + Exonic
1149975249 17:61259122-61259144 CTTCTAGGAGGCAGAAGAGTGGG + Intronic
1150652022 17:67016528-67016550 CTGGTTGGAAGCATGAGAGGTGG + Intronic
1151102587 17:71572850-71572872 CTAGTGGGAAGCTAAATAGTTGG + Intergenic
1151507596 17:74539711-74539733 CTGGAGGCAGGCAGAGGAGTGGG - Intergenic
1151972984 17:77468442-77468464 GTGGATGGAAGCTGAAGAGTAGG + Intronic
1152312960 17:79561939-79561961 TGGGTGGGCAGCAGAAGAGATGG + Intergenic
1152901153 17:82941813-82941835 CTCATGGGAAGCAGATGAGGAGG - Intronic
1155816358 18:30316271-30316293 TGGGTGGGGAGCAGATGAGTGGG - Intergenic
1156368376 18:36450320-36450342 CTGGTGGGAAGGAGAAGACTAGG + Intronic
1156407540 18:36797115-36797137 TTTGTGGGATGCAGGAGAGTTGG + Intronic
1156716430 18:40017880-40017902 CTGTTCTGAATCAGAAGAGTGGG - Intergenic
1157508263 18:48247588-48247610 TTGGAGTGAAGCAGAAGAGGTGG - Intronic
1157518819 18:48330732-48330754 CTGGTGGGAAGAAGAAAAGGGGG + Intronic
1157696371 18:49726882-49726904 ATGGAGGGGAGCAAAAGAGTTGG - Intergenic
1159069220 18:63604907-63604929 CTGGTCAGAAGCAGAAGAGCTGG - Intergenic
1160291648 18:77600027-77600049 CCTGTTGGAAGCAGAAGACTTGG + Intergenic
1162334496 19:10052139-10052161 CAGCTAGGAAGCAGAAGAGCTGG + Intergenic
1163176337 19:15566390-15566412 CTGCTGGGAGGTAGATGAGTTGG - Intergenic
1163428379 19:17251705-17251727 CTGTTGCGAAGGAGAAGAGAGGG + Intronic
1164283621 19:23790824-23790846 CTGGTGGGAAGCAGCTGTGGTGG + Intronic
1164578461 19:29419560-29419582 CTGAGTGGAAGCAGAAGGGTGGG - Intergenic
1165094344 19:33402337-33402359 CTTGTGGGAAGCAGAGGAGGAGG + Intronic
1166095966 19:40539333-40539355 CTGGTGGATAGCAGGAGTGTGGG + Intronic
1167022790 19:46891021-46891043 CTGGTGGGAGGTAGGATAGTTGG + Intergenic
1167277992 19:48550407-48550429 CTGATGGTAAGCAGAAAAGGAGG - Intergenic
1167604920 19:50476526-50476548 CTGGTGGGAAGAAGCCGAGATGG + Exonic
1167640966 19:50681218-50681240 CAGGTGGGAAGGAGCAGAGAAGG + Intronic
1167647979 19:50716084-50716106 CTGGTCAGAAGCAGAACAGATGG + Intronic
1167894676 19:52571293-52571315 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1167903152 19:52637342-52637364 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167909326 19:52689446-52689468 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167925848 19:52820593-52820615 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167930034 19:52856582-52856604 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167934169 19:52892814-52892836 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167937845 19:52922371-52922393 CTGGTGGCAAGGAGAACAGAGGG - Intergenic
1167943931 19:52972275-52972297 CTGGTGGTAAGTAGAAGTTTTGG - Intergenic
1167995221 19:53396172-53396194 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1167999479 19:53432968-53432990 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1168031433 19:53682992-53683014 CTGGAGGGAAGCAGGAGGCTGGG + Intergenic
1168115643 19:54220268-54220290 CTGGGCGGAAGCAGGAGAGTGGG - Intronic
1168118630 19:54240014-54240036 CTGGGCGGAAGCAGGAGAGTGGG - Intronic
925764010 2:7213505-7213527 CTGGTGTGAAGCAAATGTGTAGG - Intergenic
925809018 2:7680223-7680245 CTGGTGTGTAGCAGCACAGTTGG + Intergenic
926795410 2:16615293-16615315 CTTGGGGGAGGCAGAAGAGAAGG - Intronic
926829734 2:16948344-16948366 CAGGTGGCAAGCAGCAAAGTTGG - Intergenic
926911948 2:17859600-17859622 CTGAGGGGAAGTGGAAGAGTTGG - Intergenic
927226422 2:20769401-20769423 CTGGAGGGAGGGAGAAGAATAGG - Intronic
927293877 2:21431136-21431158 CTGGAAGGAAACAGAAGAGATGG + Intergenic
927510107 2:23639117-23639139 CCTGTGGGAAGCAGATGAGGAGG - Exonic
928537929 2:32258150-32258172 CTGGAGGGTTGGAGAAGAGTTGG - Intronic
929670333 2:43872203-43872225 CTGCTGGGAGGCAGAAGATGTGG - Exonic
929859611 2:45665823-45665845 GTAGTGGGAAGCAGAAGCCTAGG - Intronic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
931631603 2:64306671-64306693 ATGCTGGGAAGCGGAAGATTTGG + Intergenic
932222462 2:70010285-70010307 CAGGTGGGAAGCACAAGAGAGGG + Intergenic
932471413 2:71961923-71961945 CCGGTAGGAAGCAGAAGACCAGG - Intergenic
932569313 2:72929910-72929932 CTGCTGGGCAGAAGAAGGGTTGG - Intronic
932718041 2:74117064-74117086 CTGATTGGGAGCAGAAGAGGTGG + Intergenic
935131652 2:100265288-100265310 CTGGGGAGAAGGAGAAGGGTGGG - Intergenic
936111827 2:109671135-109671157 CTGGTAGGAAGCAGCAGTGTGGG - Intergenic
936269225 2:111036187-111036209 CTGGAGGGGAGGGGAAGAGTGGG + Intronic
936732106 2:115395213-115395235 ATGGGGAGAGGCAGAAGAGTGGG - Intronic
937271701 2:120656973-120656995 CTGGTGGGATGAGAAAGAGTGGG + Intergenic
938322974 2:130377571-130377593 CGGGTGGGAGGCAGGAGAGGAGG - Intergenic
939730210 2:145775145-145775167 CTGGTGGGTAGGACAAGATTGGG - Intergenic
940727897 2:157356014-157356036 CTAGTCAGAAGCAGAACAGTTGG - Intergenic
941202748 2:162532977-162532999 ATGGTGGGAAGCAGAAGAAAAGG + Intronic
941453598 2:165690228-165690250 CTTGTGGGCAGCAGAAGACGTGG - Intergenic
942679189 2:178458963-178458985 ATGGTGGCAAACAGAGGAGTAGG + Intronic
943360267 2:186911015-186911037 CATGTGCGAAGCTGAAGAGTGGG + Intergenic
943948879 2:194103722-194103744 TTGGTGGGGCGCATAAGAGTTGG - Intergenic
944081916 2:195797627-195797649 ATGGTGGGTAGGAGTAGAGTGGG - Intronic
944923062 2:204435624-204435646 CTGGAGGGCAGCAGGGGAGTGGG - Intergenic
944937215 2:204581874-204581896 TTGTTGGGAAGCAGCAGAGTAGG - Intronic
946734464 2:222740539-222740561 TTGGTAGGAAGCAGAAGCATCGG + Intergenic
948387882 2:237592925-237592947 CTAGTGGGAAACAGAGGAGGGGG - Intronic
948802359 2:240438630-240438652 CTCGTGGGAAGGAGAGCAGTTGG + Intronic
1168749377 20:271268-271290 CTGGTGGGAGGCAGCACAGAAGG + Intronic
1169509342 20:6246668-6246690 ATGGTGGGAATTAGAAGAGGAGG + Intergenic
1169583736 20:7057366-7057388 CTGGTAGGAAATAGAAGGGTAGG + Intergenic
1169797890 20:9484721-9484743 GTGGTGGGAAGAGGAGGAGTTGG + Intergenic
1170632614 20:18078308-18078330 ATGCTGGGAAGCAGAGGAGGGGG + Intergenic
1170908169 20:20535940-20535962 CTGGGGGGAAGAAGAACACTGGG + Intronic
1172589026 20:36104793-36104815 CAGGTGGGAAGCAGAGGCCTGGG + Intronic
1173759136 20:45544622-45544644 CTGAGGGGATGAAGAAGAGTAGG - Intronic
1174283635 20:49456891-49456913 CAGCTGGGAAGCAGCAGAGCTGG + Intronic
1174379694 20:50148632-50148654 CTGCCTGGAACCAGAAGAGTTGG - Intronic
1174393364 20:50231723-50231745 CTGGTGGGGAGCAGACAGGTGGG + Intergenic
1175927505 20:62478079-62478101 CTGGTGGGAAGCTGGCGAGGAGG - Intergenic
1178188486 21:30253296-30253318 CTGGTGAGAATGAGAAGAGAAGG + Intergenic
1178428678 21:32500075-32500097 GGGGTAGAAAGCAGAAGAGTAGG + Intronic
1179029722 21:37710355-37710377 CTGGTGGGCAGCCAATGAGTGGG + Intronic
1179381262 21:40901478-40901500 CAGGTGAGAAACAGAAGGGTTGG + Intergenic
1179929387 21:44557476-44557498 CTGGTGAGAAGATGATGAGTGGG + Intronic
1182891298 22:33820897-33820919 CATGTGGGAGGCAGAAGAGGGGG - Intronic
1182900249 22:33892319-33892341 CTGCTGGTCAGAAGAAGAGTAGG - Intronic
1183454087 22:37912130-37912152 CTGGTGGGAAGCAGAGGGTGGGG - Intronic
1183748557 22:39706076-39706098 GTGGTGGGAGGCAGGTGAGTAGG + Intergenic
1184076999 22:42187238-42187260 TTGGAGGGAAGCAGATGACTGGG - Intronic
1184329069 22:43814523-43814545 CTGGTGAGAAGCATAACAGCAGG - Intergenic
950113470 3:10435276-10435298 CTGGTGGCCAGCAGAAGACCAGG - Intronic
950172278 3:10847179-10847201 CCGGTGGGAAGCAGAAGATTGGG + Intronic
950744595 3:15076996-15077018 CTCCTGGGAAGCAAAAGAGCAGG + Intronic
952402589 3:32976627-32976649 CAGAAAGGAAGCAGAAGAGTTGG - Intergenic
952610996 3:35208967-35208989 CTTCTGGGAAACAGAAGAGAAGG + Intergenic
952615574 3:35268395-35268417 CAGTTGGCAAGTAGAAGAGTAGG - Intergenic
952887751 3:38021981-38022003 CTGATTGGAAGCAGGAGACTGGG - Intronic
952949462 3:38508515-38508537 GTGGAGTGAAGCAGAAGAGGTGG + Intronic
953196353 3:40738026-40738048 CTGGTGGTCAGGAGAAGAGAAGG + Intergenic
954105361 3:48406940-48406962 CTGGTTGGGAGCAGGGGAGTGGG - Intronic
954416829 3:50397386-50397408 CTGGTGGGGTGCAGTGGAGTGGG + Intronic
956444377 3:69311526-69311548 ATTGTGGGAAGGAGAAGAGATGG + Intronic
958022352 3:88013071-88013093 CTGGTGGGAATAATAATAGTGGG + Intergenic
961201034 3:125045532-125045554 CTGGTGGGAGGCAGAAGAGATGG + Intronic
961344605 3:126255895-126255917 CTGGTAAGTAGCAGAACAGTGGG - Intergenic
962084196 3:132173520-132173542 CTGGTGAGGAGCAGCAGAGGTGG - Intronic
962422109 3:135237949-135237971 GTGGAGGGAAGCAGAAGAAAAGG - Intronic
963564820 3:146916126-146916148 CTGGTGGGAAGAAGAAGAAGAGG + Intergenic
965608334 3:170518850-170518872 CTGGTGCCAAGAAGAAGAGAGGG + Intronic
966818153 3:183905804-183905826 AGGGTGGGAAGCAGAAGACCTGG - Intergenic
966827602 3:183978201-183978223 AAGCTGAGAAGCAGAAGAGTGGG - Intronic
966862523 3:184238540-184238562 CTGCTGGGAGGCAGTAGAATGGG - Intronic
967196357 3:187029716-187029738 CTGGTGTGGAGCAGAACAGAGGG + Intronic
968486669 4:866281-866303 CTGGTGGGAAACAGAGCTGTGGG - Intronic
969926956 4:10594105-10594127 CTGGTGGGAAGCAGAAGAGTGGG - Intronic
970368957 4:15389009-15389031 CTGGTGGGGTGCAGGAGAGGAGG + Intronic
970572989 4:17400816-17400838 CTGATGGGAAGCACATGTGTTGG - Intergenic
971299873 4:25433263-25433285 GTGGTTGGAGGCAGAAGTGTAGG + Intergenic
972702088 4:41503931-41503953 GTGCTCGGAGGCAGAAGAGTTGG - Intronic
973343377 4:49029060-49029082 CTGTTGGGGACCAGAAGACTTGG + Intronic
973836784 4:54817938-54817960 ATGGAGGGAAGTAGCAGAGTAGG - Intergenic
973967554 4:56179592-56179614 CAGCTGGTAAGTAGAAGAGTTGG - Intronic
973971015 4:56213764-56213786 TTGGTGATTAGCAGAAGAGTAGG + Intronic
975260403 4:72291043-72291065 CAGCTGGGTAGCAGAAGAATGGG - Exonic
977272241 4:94931486-94931508 TTTGGGGGAAGCTGAAGAGTAGG + Intronic
978035256 4:103985237-103985259 CTCATGGAAAACAGAAGAGTAGG + Intergenic
979041525 4:115803396-115803418 GTGGTGGGAAGCACTAGAATGGG - Intergenic
979175047 4:117652237-117652259 CTGGTGGGGTGCAGCAGAGGTGG + Intergenic
981438358 4:144752876-144752898 CTGGTGGGAAGAAGAAAGGGAGG + Intergenic
981832089 4:149013675-149013697 GTGTTGTGATGCAGAAGAGTTGG + Intergenic
983372049 4:166872881-166872903 CTGGTGGAATGCAGAAGGGAAGG + Intronic
984998942 4:185465926-185465948 CTGGGGGAAAACAGTAGAGTAGG + Intronic
986241222 5:5961603-5961625 ATGGGGAGAAGCAGCAGAGTCGG + Intergenic
986711383 5:10490478-10490500 ATGGTGGGAAGAAGACGCGTGGG + Intergenic
987899996 5:23998949-23998971 CAGGAGGGAAGCAGTAAAGTTGG - Intronic
988706835 5:33734900-33734922 CGGGTGGGAATCAGAAGTGCTGG - Intronic
988987027 5:36630392-36630414 CTGTGGGGAAAGAGAAGAGTGGG - Intronic
993630714 5:90282644-90282666 TTGTTGGGGAGCAAAAGAGTCGG - Intergenic
994551684 5:101241747-101241769 CTGGTGGGATCCATAAAAGTTGG - Intergenic
994710690 5:103259789-103259811 CAGGTGGGAAGCGGAGGAGAGGG + Intronic
995884771 5:116882074-116882096 ATGCTGGGTGGCAGAAGAGTAGG - Intergenic
996322711 5:122237091-122237113 TTGGTGGGAAGCAGGGGAGTAGG + Intergenic
997479049 5:134169296-134169318 TTGGTGGGAGGGAGAAGAGAGGG - Intronic
998584023 5:143406605-143406627 AAAGTGGGCAGCAGAAGAGTGGG - Intronic
998625543 5:143841735-143841757 GTGGTTGGAAGCAGAGAAGTGGG + Intergenic
998785867 5:145708142-145708164 CTGGTGGGGAGGGGAAGAGCGGG - Intronic
1000199997 5:158998721-158998743 CTGAAGGGAAGCACAAAAGTAGG + Intronic
1000656659 5:163887568-163887590 CTAGTTGGAGGCAGAAGAGATGG - Intergenic
1000768867 5:165325924-165325946 CAGGTGGGAGGCAAGAGAGTGGG + Intergenic
1001050222 5:168408229-168408251 CAGCTGGGAAGCAGCAGAGCAGG + Intronic
1001283336 5:170403968-170403990 CTGTGGGGAAGAAGCAGAGTGGG + Intronic
1001668048 5:173449646-173449668 CTGGTAGGAGACAGAAAAGTGGG + Intergenic
1002133510 5:177095132-177095154 CTTGTGGGAAACAGAGCAGTGGG - Intronic
1003652429 6:7973651-7973673 CAGGTGGGAAGCCTAAGGGTAGG + Intronic
1004167567 6:13270392-13270414 CAGCTGGGAAGCAGGAGGGTGGG - Intronic
1004459547 6:15822963-15822985 CAAGAGGGAAGCAGAAGAGAAGG - Intergenic
1004531722 6:16460665-16460687 CTGTTGGGAAGCATAAGTCTGGG - Intronic
1004987850 6:21102856-21102878 CTGGCAGGAAGCAGAAAGGTAGG - Intronic
1006415623 6:33902102-33902124 CTGGTAGGCAGCAGCAGAGGGGG + Intergenic
1007705821 6:43790563-43790585 CTTGTGGGAGGGAGGAGAGTGGG - Intergenic
1008376999 6:50803138-50803160 CTGAAAGGAAGCAGAAGAGAGGG - Intergenic
1010157734 6:72814161-72814183 AGGGTGGGAAGCAGAAGACAAGG + Intronic
1010209912 6:73354407-73354429 GTCGCGGGAAGCGGAAGAGTTGG - Intergenic
1013350205 6:109298772-109298794 GTGGTGGGAAGGAGGAGAGGTGG - Intergenic
1013474273 6:110493248-110493270 GTGGTGGGATGCTGAAGTGTGGG - Intergenic
1014832250 6:126116464-126116486 CTTATGGGAAGAAGAAGAGATGG - Intergenic
1016225359 6:141728633-141728655 ATAGTGTGAAGCAGAAGAATAGG - Intergenic
1016288919 6:142506570-142506592 CTGGTGATGAGCAGAGGAGTGGG + Intergenic
1017756512 6:157533720-157533742 CTAGGGGGAAGCAGAAGAGCCGG + Intronic
1018531511 6:164768794-164768816 CTGGAGGAGAGTAGAAGAGTGGG + Intergenic
1021191241 7:17622137-17622159 CTGGTGGCCAAGAGAAGAGTGGG - Intergenic
1021563710 7:21995096-21995118 GGGCTGGGAAGCAGGAGAGTTGG + Intergenic
1022233793 7:28441442-28441464 CTGATGGGAAGCTGAAGTGAAGG - Intronic
1022383271 7:29880650-29880672 CTGGTGACAAGCAGACCAGTAGG - Intronic
1022496191 7:30854639-30854661 TTGGTGGTAAGCCGGAGAGTGGG + Intronic
1023145036 7:37142561-37142583 CTGGTGGTAAGGAAAAAAGTAGG - Intronic
1024528791 7:50373252-50373274 CAGGTGGGGAGCAGAACAGCAGG - Intronic
1026338467 7:69414916-69414938 GTGGTGGGAGGCAGAAGATGAGG - Intergenic
1028328002 7:89550300-89550322 GTGGTGGGGAGCAGATGAGAAGG - Intergenic
1028668623 7:93375456-93375478 CAGTTGGGAAGCAGAAGGGATGG - Intergenic
1029415805 7:100442429-100442451 CTGCTGGGATGCAGAAAAGTTGG + Intergenic
1030251601 7:107451571-107451593 ATGGAGGGAGGTAGAAGAGTAGG - Intronic
1031565692 7:123294554-123294576 AAAGAGGGAAGCAGAAGAGTAGG + Intergenic
1032344068 7:131103757-131103779 CTGGTAGCAAGCAGCAGAGAAGG + Intergenic
1033756080 7:144399077-144399099 CAGGTGGGGGGCTGAAGAGTGGG + Exonic
1034367899 7:150567761-150567783 CTGGTGGGAAGAGGAACATTGGG + Intronic
1036535197 8:9643349-9643371 ATGGTGGAAGGCAGAAGAGCAGG + Intronic
1036949151 8:13124375-13124397 AAGCTGGGAAGCAGAAGTGTTGG + Intronic
1037367845 8:18142013-18142035 CTGCTGGGAAACAGAATAATTGG - Intergenic
1037367995 8:18143361-18143383 CTGCTGGGAAACAGAATAATTGG - Intergenic
1037801747 8:22039812-22039834 CTGCTGAAAAACAGAAGAGTTGG - Intergenic
1038944841 8:32347302-32347324 ATGCTGGGAAGGAGAAGAGCAGG - Intronic
1039516178 8:38135798-38135820 CTTGAGGGAAGCAGATGAATGGG + Intronic
1041009852 8:53530971-53530993 TTGGTGGGCAGCAGAAATGTTGG - Intergenic
1041542786 8:59005802-59005824 CTGGTGGGTACCAGGAGACTAGG - Intronic
1042708765 8:71691504-71691526 CTAGTGGTAAGCAGAAAAGAGGG - Intergenic
1043935261 8:86135461-86135483 GTGCTGGCAAGCAGCAGAGTTGG - Intronic
1044752538 8:95430191-95430213 CTGGTGGGAAGAGGAAAAGGTGG + Intergenic
1044934106 8:97277332-97277354 CTGGTGGGAGGCAGAAGAAAGGG - Exonic
1045055427 8:98364249-98364271 CTGATGGAAAGCAGGCGAGTGGG - Intergenic
1045681700 8:104667485-104667507 CTGGTGGGCAGCAGATGTGCTGG - Intronic
1047445584 8:124916219-124916241 CTAGTGGGAAGAAGAAGACCAGG - Intergenic
1049389057 8:142358852-142358874 CTGGAGGGAAGTGGAAGCGTGGG - Intronic
1049698869 8:143997710-143997732 CTGCTGGGAAAAAAAAGAGTGGG - Intronic
1050034109 9:1416917-1416939 TTGGTGAGATGCTGAAGAGTTGG + Intergenic
1050041170 9:1495489-1495511 CTGGTGGTGAGGAGAACAGTGGG + Intergenic
1052788956 9:32856176-32856198 CTGGTGGTAACCAGATGATTGGG + Intergenic
1053091486 9:35281920-35281942 GTGGAGGGAATAAGAAGAGTGGG + Intronic
1055255344 9:74363165-74363187 CAGGAGGGAAGCAGAGGAGATGG - Intergenic
1055496161 9:76857713-76857735 GTGGGGGGAAGCTCAAGAGTGGG - Intronic
1055567341 9:77582379-77582401 CTGGTGGAAAGCAGTAGGGGAGG - Intronic
1056153067 9:83806561-83806583 CTGTGGGGAGGCAGAAGAGTAGG + Intronic
1056620194 9:88206117-88206139 CAGGAGGAAAGGAGAAGAGTGGG + Intergenic
1056757160 9:89388969-89388991 CTGGCCGGGAGCAGATGAGTCGG + Exonic
1057455875 9:95209746-95209768 ATGGAGGGAAGCAGATGAATTGG - Intronic
1058459062 9:105166021-105166043 ATGGTGGGAGCCAGAAGTGTTGG + Intergenic
1058807201 9:108604123-108604145 CTGGGGGGAGCCAGGAGAGTGGG - Intergenic
1060491097 9:124084882-124084904 TTGGTGGAATGCAGAAGAGAAGG + Intergenic
1060884700 9:127142479-127142501 CTGGAGGGAAGCAGAAGTCAGGG + Intronic
1061940519 9:133881389-133881411 CTGATGGGATGCAGGAGAGCTGG - Intronic
1062003961 9:134230115-134230137 CAGGTGGGAAGCTGCAGAGCAGG - Intergenic
1186421009 X:9426443-9426465 ATGGTGGAAAACAGGAGAGTGGG + Intergenic
1186473156 X:9836867-9836889 GTGGTGGGAACCAGAAGGGATGG - Intronic
1187021269 X:15384985-15385007 CTAGTGGAAAGCGGAAGAGCAGG - Exonic
1187438330 X:19293266-19293288 CAGAAGGGAAGCAGAAGAGATGG + Intergenic
1188410800 X:29869852-29869874 GAGGGGGCAAGCAGAAGAGTTGG + Intronic
1190333876 X:49251269-49251291 CTGGTGGGAGGCAGAGGTGGTGG - Exonic
1190598435 X:52067817-52067839 CTGCTCGGAAGAAGAAGATTTGG - Intronic
1190610389 X:52186256-52186278 CTGCTCGGAAGAAGAAGATTTGG + Intronic
1190774613 X:53542703-53542725 GTGGAGAAAAGCAGAAGAGTTGG - Intronic
1192060960 X:67825361-67825383 CTGGTGAGAATGAGAAGAATAGG + Intergenic
1192156146 X:68748092-68748114 CTCAGGGGAAGAAGAAGAGTTGG + Intergenic
1192435009 X:71137703-71137725 CTGGAGGGAAGAAGGAGAGAGGG - Intronic
1194114060 X:89873871-89873893 TTGGTAGGGAGCAGCAGAGTTGG + Intergenic
1194713853 X:97268184-97268206 ATGGAGAGAAGTAGAAGAGTGGG - Intronic
1195738990 X:108043081-108043103 AAGGTGGGAGGCAGAAGAGAAGG + Intergenic
1196778973 X:119365408-119365430 CTGGTGGCCAGCATAAGAATGGG - Intergenic
1198276131 X:135097676-135097698 CTGGTGGGGAAGAGAAGGGTGGG + Intergenic
1198310382 X:135423064-135423086 CTGGTGGGGAAGAGAAGGGTGGG - Intergenic
1199709246 X:150456843-150456865 GGGCTGGGAGGCAGAAGAGTGGG + Intronic
1199794687 X:151182942-151182964 CTTGGGGGAATCAGAAGACTTGG + Intergenic
1199945778 X:152665931-152665953 CTGGTGGGGTGCAGTCGAGTGGG - Intergenic
1200181866 X:154155652-154155674 CTGGCGGCAGGCAGATGAGTGGG - Intronic
1200187515 X:154192766-154192788 CTGGCGGCAGGCAGATGAGTGGG - Intergenic
1200193165 X:154229906-154229928 CTGGCGGCAGGCAGATGAGTGGG - Intronic
1200198920 X:154267710-154267732 CTGGCGGCAGGCAGATGAGTGGG - Intronic
1200466800 Y:3529227-3529249 TTGGTAGGGAGCAGCAGAGTTGG + Intergenic
1201416345 Y:13752248-13752270 CTGCTGGGAAGGACAAGACTGGG - Intergenic