ID: 969929235

View in Genome Browser
Species Human (GRCh38)
Location 4:10613965-10613987
Sequence GCCTGGGCATTCAGGGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969929235_969929244 8 Left 969929235 4:10613965-10613987 CCAAGGACCCTGAATGCCCAGGC 0: 1
1: 0
2: 2
3: 22
4: 254
Right 969929244 4:10613996-10614018 GTGGCAACCACCATACCAACTGG 0: 1
1: 0
2: 0
3: 5
4: 73
969929235_969929248 29 Left 969929235 4:10613965-10613987 CCAAGGACCCTGAATGCCCAGGC 0: 1
1: 0
2: 2
3: 22
4: 254
Right 969929248 4:10614017-10614039 GGAGATTGAGAGAGCAACATCGG 0: 1
1: 0
2: 2
3: 21
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969929235 Original CRISPR GCCTGGGCATTCAGGGTCCT TGG (reversed) Intronic
900184494 1:1326660-1326682 GATTGCGCATTCAGGGACCTTGG - Intronic
900407924 1:2500590-2500612 GCCTGGGCATGCAGGGGCGGCGG - Intronic
900702530 1:4057211-4057233 GGCTGGGCTGTCAGGGTCCAGGG - Intergenic
900763743 1:4489628-4489650 GCCTGGGCAATCAGGTGCCAGGG + Intergenic
902181053 1:14688727-14688749 ACCTGACCATTCAGTGTCCTTGG - Intronic
903261823 1:22135767-22135789 GCCTGGGCCTTGAGAGACCTAGG - Intronic
903265816 1:22157292-22157314 TTCTGGGCAATCAGGGTCCTGGG - Intergenic
903432907 1:23321982-23322004 GACTGATCATTCAGGGTCCTTGG + Intronic
903848421 1:26291829-26291851 GCCTGGGCCTACAGTGCCCTGGG + Intronic
905816205 1:40952882-40952904 ACCTCAGCATTCAAGGTCCTTGG + Intergenic
907284615 1:53371632-53371654 GCCTGGGCACCAGGGGTCCTGGG + Intergenic
907562869 1:55406952-55406974 GCCTGGGCAGTGTGAGTCCTGGG - Intergenic
908555715 1:65254748-65254770 GCCTAGGCATCCAGGCTCCCAGG - Intronic
908687675 1:66740097-66740119 GCCTTTGCAGTTAGGGTCCTAGG - Intronic
909209043 1:72799127-72799149 GCCTTAATATTCAGGGTCCTAGG - Intergenic
910260861 1:85292585-85292607 GCCTGGGCATCAAGGAGCCTGGG - Intergenic
912571569 1:110628170-110628192 CCCTGAGCATTAATGGTCCTGGG + Intronic
913960263 1:143333851-143333873 GGCTGGGCACTGCGGGTCCTCGG - Intergenic
914054619 1:144159424-144159446 GGCTGGGCACTGCGGGTCCTCGG - Intergenic
914124527 1:144806937-144806959 GGCTGGGCACTGCGGGTCCTCGG + Intergenic
915007727 1:152655636-152655658 GCCTGGGAATTAAGAGTCCCTGG + Intergenic
915679695 1:157568830-157568852 ACATGGTCATTCAGGATCCTAGG - Intergenic
915973981 1:160372902-160372924 GGGTGGGCATTGAGGGTCCTAGG + Intergenic
916918364 1:169436127-169436149 GGCTGGGAATTCAGAGACCTGGG - Intronic
919333841 1:196206985-196207007 ACATGGTCATTCAGGGACCTAGG + Intergenic
921892895 1:220370739-220370761 TCCTGGTCATTCCAGGTCCTGGG + Intergenic
922218571 1:223540424-223540446 TCCTTTGCTTTCAGGGTCCTGGG - Intronic
922682290 1:227610656-227610678 GCCTGGACATTCTGGTGCCTTGG + Intronic
924696526 1:246406133-246406155 GCCTGGGAGTTCAAGCTCCTGGG - Intronic
1066106832 10:32164087-32164109 GCCTCGGCCTTCAGAGTGCTGGG + Intergenic
1066759596 10:38739350-38739372 GCCAGGGCTGTCAGGGTCATTGG - Intergenic
1066962026 10:42233410-42233432 GCCAGGGCTGTCAGGGTCATTGG + Intergenic
1067246665 10:44553138-44553160 GCCTGTGCATGGAGGGTCCAGGG + Intergenic
1070401002 10:76053595-76053617 GCCTGTCCTTTCATGGTCCTGGG - Intronic
1071568116 10:86681836-86681858 GCCTGGGCCACCTGGGTCCTCGG + Intronic
1072950851 10:99845540-99845562 GCCTGGGCATTCACAGTCACAGG - Intronic
1074545412 10:114398702-114398724 GCCTGGGCACTCAGGGGCTCGGG - Intronic
1075894555 10:125983749-125983771 GCCTGGGCCTTGAGGGTTATTGG + Intronic
1076065840 10:127447332-127447354 CCCTGAGCATTCAGGCTCCGTGG + Intronic
1076335593 10:129704420-129704442 GCCTGTGTATTAAGGGTACTGGG + Intronic
1077032586 11:476196-476218 GGCTGGGCAGACAGGGCCCTGGG - Intronic
1077263145 11:1633980-1634002 GCGTGTGCATGCAGGGCCCTGGG + Intergenic
1077341231 11:2027256-2027278 ACCTGGGCAGTCAGGGACCATGG - Intergenic
1077663167 11:4086838-4086860 GCCTGGGCATTCAGAGAGCTTGG + Intronic
1079033012 11:16999534-16999556 GCCTGGGAAGCCAGGTTCCTGGG - Intronic
1079470175 11:20770533-20770555 GTTTGTGCATTCAGGTTCCTGGG - Intronic
1080768308 11:35317238-35317260 GCCTGGGCAGACAGGGCCCTAGG + Intronic
1083237588 11:61361694-61361716 GGCTGGGAGTTCAGGGACCTGGG - Intronic
1083308159 11:61771546-61771568 ATCTGGGCATTGAGGGTGCTGGG - Exonic
1083314010 11:61802998-61803020 GCCTGGGGAAGCAGGGTCCTGGG - Intronic
1083524727 11:63352037-63352059 GCCTTGGCCTGCATGGTCCTAGG + Intronic
1083862365 11:65428423-65428445 GCCCTGGCATTAAGGGTCCTTGG - Intergenic
1084938553 11:72600385-72600407 GCCTAAGAATTGAGGGTCCTTGG - Intronic
1085520697 11:77137547-77137569 GCCTGGGCCTTCCGGACCCTCGG + Intronic
1085533928 11:77207051-77207073 GCCTTGGCGTCCAGAGTCCTGGG - Intronic
1087733951 11:101810648-101810670 GTCTGAGCATGCAGGGTCATGGG + Intronic
1088837650 11:113591349-113591371 GCCTGAGCATGCTGGGGCCTGGG + Intergenic
1089273281 11:117315918-117315940 GCCAGGGCCTGCAGGGCCCTGGG + Exonic
1091296239 11:134475783-134475805 TCCTGAGCACTGAGGGTCCTAGG - Intergenic
1202824216 11_KI270721v1_random:82445-82467 ACCTGGGCAGTCAGGGACCATGG - Intergenic
1091829463 12:3539453-3539475 GGCTGGGAATCCAGGCTCCTGGG - Intronic
1092036204 12:5337243-5337265 GCCTTACCATTCAGGGTCATTGG + Intergenic
1093028657 12:14267901-14267923 GCCTGCGCTTGCAGGCTCCTGGG - Intergenic
1093534228 12:20203219-20203241 GCCTGGACTTTCAGGCTCCCTGG + Intergenic
1094167475 12:27457183-27457205 GCCTGGGGAGTCAGGGTTCAGGG - Intergenic
1097407408 12:59207202-59207224 GTCTGTGCTTTCAGGGTCATAGG - Intergenic
1100091551 12:90978113-90978135 CCCTGTGAATTCAGGCTCCTGGG + Exonic
1102825363 12:115943976-115943998 GCCTGTTCCTTCAGGGTCTTAGG + Intergenic
1103884675 12:124191549-124191571 GCCTGGGCATGCAGGGGCGTGGG - Intronic
1104219417 12:126767464-126767486 GTCTGGGGCTTCAGGGTCATTGG + Intergenic
1105210694 13:18255078-18255100 GACTGGTCATGCAAGGTCCTGGG - Intergenic
1106846673 13:33744424-33744446 GCGTGTGCACTCAGGGTGCTTGG + Intergenic
1107904365 13:45048555-45048577 GCCTGGGCATTAAAGCTGCTAGG - Intergenic
1107993142 13:45836031-45836053 GCCTGGGGATACAGAGCCCTTGG + Intronic
1108001891 13:45911451-45911473 GCCTGGGCAGGCAGGGTCAAAGG + Intergenic
1108441667 13:50459579-50459601 GCCTAGGCCTTAAGGGGCCTTGG + Intronic
1113599385 13:111557954-111557976 GCCTGTGCATGCAGGCTCCTGGG + Intergenic
1114632265 14:24166710-24166732 GCCTGGGCCCTGTGGGTCCTGGG + Exonic
1116689756 14:48090392-48090414 GCTTGGGCAATCAGGGTACCAGG - Intergenic
1118380509 14:65214080-65214102 GCCTGGTCATTCAGGGGCCATGG + Intergenic
1122586039 14:102807266-102807288 TCCTGGGCAGGCAGGCTCCTGGG - Intronic
1123063751 14:105606079-105606101 CCCTGGGCACCCAGGGTCCCAGG - Intergenic
1123143495 14:106105906-106105928 GCCTGGACTTTCAGGATCCCAGG + Intergenic
1123443029 15:20304055-20304077 GCCAGGGCTGTCAGGGTCATTGG - Intergenic
1125118974 15:36130072-36130094 GGCTGGTCATTCTGGGTCCCCGG + Intergenic
1127577931 15:60310575-60310597 GCTTGGCCATTCATTGTCCTAGG + Intergenic
1128318510 15:66676578-66676600 GAGTAGGCATTGAGGGTCCTGGG - Intronic
1129239324 15:74242334-74242356 GCCTCGGCAGGCTGGGTCCTTGG - Intronic
1129454181 15:75667652-75667674 ACCTGGGCAGTCAGGTTCTTTGG + Intergenic
1129480796 15:75824118-75824140 GCCTGGGTGTTCAGGGTCAGGGG - Intergenic
1130060948 15:80569598-80569620 GCCAGAGCAGTTAGGGTCCTGGG + Intronic
1130766434 15:86876172-86876194 GGCTGGGGTTTCAGAGTCCTTGG - Intronic
1131019912 15:89088862-89088884 TCCTGGGTCTTCAGGGGCCTGGG + Intronic
1132670302 16:1099792-1099814 GCCTGGGCTTTCCCGGGCCTCGG + Intergenic
1135091627 16:19522274-19522296 ACCTGGGCGTTCAGACTCCTAGG + Intergenic
1135851169 16:25965227-25965249 GCCTCAGCATTCGGGATCCTTGG + Intronic
1136723209 16:32339898-32339920 GCCAGGGCTGTCAGGGTCATTGG + Intergenic
1136773751 16:32860519-32860541 GCCAGGGCTGTCAGGGTCATTGG - Intergenic
1136841530 16:33545902-33545924 GCCAGGGCTGTCAGGGTCATTGG + Intergenic
1136862787 16:33713102-33713124 GCCAGGGCCATCAGGGTCATTGG - Intergenic
1136896861 16:34001000-34001022 GCCAGGGCTGTCAGGGTCATTGG + Intergenic
1138152301 16:54669989-54670011 CACTGGGACTTCAGGGTCCTGGG - Intergenic
1138492488 16:57384470-57384492 GCCTGGCCCCTCAGGGTCCCTGG + Exonic
1139751410 16:69111130-69111152 GCCTAGAAATCCAGGGTCCTAGG - Intronic
1141021031 16:80496768-80496790 TCCTGAGCAATCAGGGTGCTAGG + Intergenic
1141930450 16:87198851-87198873 TCCTGGCCAGTCAGGGTGCTTGG + Intronic
1203003222 16_KI270728v1_random:177866-177888 GCCAGGGCTGTCAGGGTCATTGG - Intergenic
1203076169 16_KI270728v1_random:1122630-1122652 GCCAGGGCTGTCAGGGTCATTGG - Intergenic
1203134829 16_KI270728v1_random:1714273-1714295 GCCGGGGCTGTCAGGGTCATTGG - Intergenic
1203151695 16_KI270728v1_random:1846199-1846221 GCCAGGGCTGTCAGGGTCATTGG + Intergenic
1143040866 17:4035543-4035565 GCCTGGGCATTCCTGGGCTTGGG - Intronic
1143302926 17:5924365-5924387 GCCTGAGCTCTAAGGGTCCTGGG + Intronic
1143505973 17:7365559-7365581 GGATGGGAACTCAGGGTCCTAGG + Intergenic
1143627480 17:8118798-8118820 CCCTGGGCCTGCAGGATCCTGGG + Exonic
1146964832 17:37017165-37017187 GACTGGGCAATCAGGGTCACCGG - Intronic
1148103001 17:45104130-45104152 GCCTGGCTATTCAGGCTCCTTGG - Intronic
1148105067 17:45114610-45114632 CCGTGGGCATTCAGTGTACTTGG - Intronic
1148770326 17:50062653-50062675 GCCTGGGCATGCCAGGGCCTGGG - Intronic
1152407247 17:80104773-80104795 GCCTGGGCATCCCGGGGCCCTGG - Intergenic
1152636797 17:81433504-81433526 CCCTGGGCACACAGGGACCTCGG - Intronic
1157601744 18:48897213-48897235 GCCTGGCCAAGCAGGGGCCTGGG - Intergenic
1160078824 18:75703868-75703890 ACCTGGGAATTCAGAGACCTGGG + Intergenic
1160078850 18:75703980-75704002 ACCTGGGGATTCAGAGCCCTGGG + Intergenic
1160538596 18:79608549-79608571 GGCTGGGCAGGCAGCGTCCTTGG - Intergenic
1160623052 18:80184233-80184255 GCCTCGGCACTGATGGTCCTAGG + Intronic
1160873542 19:1287275-1287297 GCCGGGGCTTTGGGGGTCCTGGG + Intronic
1161152056 19:2714719-2714741 GCCTGGGCATCCCTGGTGCTGGG - Exonic
1163628315 19:18403582-18403604 TCCTGGGGACTGAGGGTCCTGGG + Intergenic
1163735546 19:18978158-18978180 GCCTTGGGTTTCACGGTCCTGGG + Intergenic
1164452444 19:28378461-28378483 GCCTGGGAGCTCAGGGTCTTGGG - Intergenic
1166368539 19:42289434-42289456 GCCTTGGCCTGCTGGGTCCTGGG - Intronic
1166998384 19:46730641-46730663 GCCTGGGCCTTCAGGGGCTGCGG - Intronic
1202694100 1_KI270712v1_random:112102-112124 GGCTGGGCACTGCGGGTCCTCGG - Intergenic
925781038 2:7382144-7382166 ACATGGGCATTCTGGGCCCTGGG - Intergenic
926207212 2:10842318-10842340 GGCAGGGCATTCATGGTCCAGGG - Intergenic
927573055 2:24176463-24176485 GCCTGGGCCTTCAGAGCACTAGG + Intronic
933131703 2:78681067-78681089 GCCTGGACTTTCAGGCTCCCTGG - Intergenic
933952460 2:87342473-87342495 GGCTGGGCACTGCGGGTCCTCGG + Intergenic
934236700 2:90238810-90238832 GGCTGGGCACTGCGGGTCCTCGG + Intergenic
934322913 2:91983689-91983711 GCCAGGGCTCTCAGGGTCATTGG - Intergenic
934559741 2:95306964-95306986 GCCTGGGCCCTCAGGCTGCTGGG - Intronic
935710455 2:105893542-105893564 TCCTGGGCACTCAGCGTGCTGGG + Exonic
936076788 2:109406364-109406386 GACTGCCCATTTAGGGTCCTCGG - Intronic
940366366 2:152852641-152852663 TCCTGGACTTTCAGGGTCCCTGG + Intergenic
944514343 2:200496741-200496763 GCCTCGGCCTTCAAGGTGCTGGG + Intronic
946898157 2:224345657-224345679 GGCTGCACAGTCAGGGTCCTGGG + Intergenic
1168876672 20:1176766-1176788 GCCTGGGCACTCAAGGTCCTTGG + Intronic
1168940999 20:1711532-1711554 GCCTGGACTTTCAGGGTCCCTGG - Intergenic
1169227679 20:3866359-3866381 TCCTTGGCTTTCTGGGTCCTGGG + Exonic
1170142747 20:13141604-13141626 GCCCCGGCATTCAAGGCCCTTGG + Intronic
1171291840 20:23986769-23986791 GACTGGTCATGCAAGGTCCTGGG - Intronic
1171493523 20:25538537-25538559 GCCAGGGCAGACATGGTCCTAGG + Intronic
1174554928 20:51387429-51387451 CCCTGAGCCATCAGGGTCCTGGG - Exonic
1175530963 20:59674105-59674127 GCCTCGGCTGTCAGTGTCCTGGG + Intronic
1176188149 20:63792906-63792928 GTCTCTGCCTTCAGGGTCCTGGG + Intronic
1176255940 20:64153037-64153059 GCCAGAGCATGCAGGGTGCTGGG - Intronic
1176370630 21:6059809-6059831 TGCTGGGCAGTCAGGGTCCCTGG + Intergenic
1178419052 21:32428950-32428972 TGCAGGGCATTCAGGGTCCAAGG + Intronic
1179730926 21:43367001-43367023 TCCTGGGGATTCAGGGCCCTGGG + Intergenic
1179752889 21:43478732-43478754 TGCTGGGCAGTCAGGGTCCCTGG - Intergenic
1179873721 21:44256838-44256860 GCCTCGGCTTTCAGAGTGCTAGG + Intronic
1180549670 22:16529583-16529605 GCCAGGGCTGTCAGGGTCATTGG - Intergenic
1180765561 22:18344337-18344359 GACTGGTCATGCAAGGTCCTGGG + Intergenic
1180813468 22:18775362-18775384 GACTGGTCATGCAAGGTCCTGGG - Intergenic
1181106853 22:20580771-20580793 TCCTGTGCATTCACGGTGCTGGG - Intronic
1181702082 22:24627264-24627286 GACTGGTCATGCAAGGTCCTGGG + Intronic
1182150351 22:28023130-28023152 TCCTGGGCATGCTGGGTCCATGG + Intronic
1182469118 22:30536455-30536477 GTCTGTGCATTCAGATTCCTGGG + Intronic
1183708054 22:39487159-39487181 GCTGGGGCTTTCAGGGGCCTTGG + Intronic
1183958393 22:41396270-41396292 TCCTGGGCGCTCAGGGTCCCTGG + Exonic
1184225239 22:43125890-43125912 GCCTGGGGTTTCAGGGGCCAAGG + Intronic
1184875639 22:47273799-47273821 GCCTTGGCATTCTGGGTTCAAGG + Intergenic
1185035508 22:48474672-48474694 TCCTGGTCCCTCAGGGTCCTAGG - Intergenic
1185281458 22:49971749-49971771 GCCTGGGCCGGCAGGGTCCCTGG + Intergenic
1203263569 22_KI270734v1_random:1044-1066 GACTGGTCATGCAAGGTCCTGGG - Intergenic
950793083 3:15488969-15488991 GCCAGGGCATTCTGGGGACTTGG - Intronic
951045815 3:18037281-18037303 GGCTGGGACTTCAGGGCCCTTGG + Intronic
951391170 3:22105836-22105858 GGCTGGGCATCCTGGGACCTAGG + Intronic
953581397 3:44160335-44160357 GCATAGTCATTCAGGGGCCTGGG + Intergenic
954335826 3:49916848-49916870 TCCTTGGCATTCAGCATCCTGGG - Exonic
957665427 3:83218933-83218955 CCCTGTGCTCTCAGGGTCCTGGG - Intergenic
960937490 3:122912743-122912765 ACCTGGGCATTGGGGTTCCTGGG + Intronic
961119554 3:124362032-124362054 GCCGTGGCATTCAGGGTAATGGG + Intronic
961390804 3:126551303-126551325 GCCGGGGCATTCAGGAGGCTAGG + Intronic
961450393 3:126999865-126999887 GCCTGGGCACTGAGAGGCCTCGG + Intronic
961571205 3:127800199-127800221 ACATGGCCATTCAGGGACCTAGG - Intronic
962317485 3:134367786-134367808 ACCTGGGCCTGCAGGATCCTGGG + Exonic
962675933 3:137758551-137758573 GCATTGGCAGTCAGGGACCTGGG - Intergenic
962698060 3:137970557-137970579 GATTTGGAATTCAGGGTCCTGGG - Intergenic
962869770 3:139477867-139477889 GACTGAGCATTCAGCCTCCTGGG + Intronic
963068678 3:141284212-141284234 ACCTGGTCATTCAGGGCCCCAGG + Intronic
963130099 3:141849930-141849952 GCTCAGTCATTCAGGGTCCTGGG + Intergenic
967045788 3:185735676-185735698 GCCTGGGTCTTCAGGTTCCTGGG - Intronic
968189723 3:196659179-196659201 AACTGGGCATTCAGAGCCCTGGG + Intronic
968758067 4:2427054-2427076 GCCTGGGCAGTGAGGCTCCCGGG + Intronic
969326253 4:6445977-6445999 GCCTTGGCTTTCAGGGTCCTTGG - Intronic
969394296 4:6910335-6910357 GCCTGGGGACTGAGGGTCCGAGG - Intronic
969631923 4:8343879-8343901 CCCTGGGCAGGCAGGGTCCCCGG + Intergenic
969899948 4:10339804-10339826 GCCTGAGTCTTCATGGTCCTCGG + Intergenic
969929235 4:10613965-10613987 GCCTGGGCATTCAGGGTCCTTGG - Intronic
976219041 4:82741325-82741347 GCCTGGGCCTTGAGAGGCCTTGG + Intronic
981806964 4:148727880-148727902 CCTTGGGCTTTCAGAGTCCTGGG + Intergenic
982579947 4:157163763-157163785 GCCTGGGGACTCAGGATCCCAGG - Intronic
983347562 4:166546330-166546352 CTCTGGGGATTCAGGGTCATGGG - Intergenic
984713290 4:182903701-182903723 GCCTCAGCTTTCAGGGCCCTGGG - Intronic
986163334 5:5250913-5250935 GCCTTTGGATTCAGAGTCCTCGG + Intronic
987816079 5:22902113-22902135 TCCTGGGCACTCAGGGGCCTGGG - Intergenic
992174047 5:74132637-74132659 GGCTGGGCATTCAAGGTACATGG - Intergenic
994067367 5:95558244-95558266 GCCAGGGCAATTAGGGCCCTAGG - Intronic
994186528 5:96821486-96821508 GCCTGGGCATTCAGGCTGATGGG + Intronic
995056844 5:107768979-107769001 GCCTGGGGGTGCTGGGTCCTGGG + Intergenic
996766189 5:127036165-127036187 GGCTGGGCATTCAGCATCCTGGG - Intergenic
997352624 5:133241788-133241810 GCCTGGGGATTCAGGATCCAAGG - Intronic
997602553 5:135150390-135150412 GCCTGGGCATTCTGGGGGCAGGG + Intronic
997661440 5:135592102-135592124 GCCTTGGCACTAAGGGACCTTGG - Intergenic
997678899 5:135735411-135735433 GCCTGGGCCTTCAAGGTCTAGGG + Intergenic
998278604 5:140783041-140783063 GCCAAGGCAGTCAGGATCCTGGG - Intergenic
1000368406 5:160511818-160511840 GCAGGGGCATCCAGGGTTCTGGG + Intergenic
1001573194 5:172744302-172744324 GGCTGGGCATGCAGGCTGCTGGG - Intergenic
1001880525 5:175240273-175240295 TCCTGGGGATTCAGAGTGCTGGG + Intergenic
1002296595 5:178234761-178234783 ACCTGGGCATTCAGGGGACAGGG - Intergenic
1003074421 6:2971181-2971203 GCCTGGGCGCCCGGGGTCCTCGG + Intronic
1003256783 6:4482266-4482288 GGTTGTGCACTCAGGGTCCTGGG - Intergenic
1003257410 6:4486563-4486585 TCCTGGGCAGTCGGGGCCCTGGG + Intergenic
1004188767 6:13446306-13446328 GCCTGGGCATGCTGGTTCTTAGG - Intronic
1005251672 6:23953022-23953044 GCCTGGGCATTCTGAGGACTTGG + Intergenic
1006080072 6:31559987-31560009 GCCTGGTCCTTCAGAGGCCTTGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007051680 6:38837269-38837291 GGCTGGGAATTTAGGGTTCTCGG + Intronic
1007859759 6:44896005-44896027 CCATGGGCATTCAGAGGCCTGGG + Intronic
1007965166 6:45997901-45997923 TCCTGGGCCTGCTGGGTCCTGGG - Intronic
1012079249 6:94735491-94735513 CCCTGGGCTTTCAGGCTCCCCGG - Intergenic
1012835165 6:104255422-104255444 GCCTGGACATTGAGAGGCCTTGG + Intergenic
1015034146 6:128632196-128632218 ACCTGGGCACTCAGGGCCATTGG - Intergenic
1016006984 6:139099269-139099291 CTCTGGGCCTTCAGGGTCATAGG + Intergenic
1019261251 7:83262-83284 GCCTGGGCATTCATGGGACATGG + Intergenic
1019315039 7:380413-380435 TTCTGAGCATTGAGGGTCCTGGG - Intergenic
1022101575 7:27172598-27172620 TCTTGGGCAATCAGGGCCCTGGG - Intronic
1022193139 7:28036753-28036775 GCCTGGGCACTCAGGGGTATGGG + Intronic
1022496205 7:30854728-30854750 GCCCAGGCCTTCAGGGTCTTTGG - Intronic
1022642670 7:32203145-32203167 GGCTGGGCTTTCAGTGTTCTCGG - Intronic
1026498560 7:70923734-70923756 GGCTGGGAATTCAGGGTGCCTGG - Intergenic
1029207741 7:98879202-98879224 GCCTGGGCCTTCGGCGTCCGGGG + Intronic
1034529136 7:151684526-151684548 GCCTTATCATTCAGTGTCCTAGG - Intronic
1035292860 7:157850697-157850719 GCCTGGGATTCCAGGTTCCTGGG + Intronic
1035479064 7:159167532-159167554 GCCTTGGCATTCATGGCCCTCGG - Intergenic
1035565734 8:639640-639662 GCCTGTGAATCCAGGGTGCTTGG - Intronic
1035565757 8:639790-639812 GCCTGTGAATCCAGGGTGCTCGG - Intronic
1038692901 8:29779499-29779521 GCCAGGCCAGTCAGGATCCTGGG + Intergenic
1039417596 8:37409095-37409117 GCCTGAGCATTATGGGACCTTGG + Intergenic
1039474029 8:37829957-37829979 GCCTGAGCATGCAGGGCACTGGG - Exonic
1042101090 8:65275697-65275719 GCCTGAGACTGCAGGGTCCTGGG - Intergenic
1044605430 8:94043527-94043549 GCGGGGGCATTCGGGGGCCTGGG - Intergenic
1045496680 8:102715337-102715359 GCCTGGGCATCCCAGGCCCTCGG + Intergenic
1048283679 8:133124261-133124283 GCCTTGGCCTCCAGGGTGCTGGG + Intronic
1048913419 8:139158669-139158691 GGCTGGGTATTAAGTGTCCTTGG + Intergenic
1048992383 8:139768360-139768382 CCCTGGGCAGTCAGGGAACTGGG + Intronic
1049595361 8:143480929-143480951 GCCGGGGCATCCTGGGTGCTGGG - Intronic
1050228649 9:3492505-3492527 GCATGGGAATTTGGGGTCCTGGG - Intronic
1052405545 9:28055378-28055400 GCCTGGCCATTCAGACTCCTTGG - Intronic
1053007491 9:34613735-34613757 GCCTGGGCAGTCAGGCTCCAGGG - Exonic
1055474384 9:76646936-76646958 GCCTTGGCCTTCAGAGTGCTGGG - Intronic
1057261874 9:93589078-93589100 CCCTGGACCTTGAGGGTCCTGGG - Intronic
1057334019 9:94142035-94142057 GCCTGGGGATTCAGGGACAAGGG - Intergenic
1058725548 9:107800049-107800071 GCCTGGGAATTCCAGATCCTGGG + Intergenic
1059695783 9:116728957-116728979 GCCTGGGCAGCCAGGGGACTTGG - Intronic
1060373025 9:123092538-123092560 GCCTGGGCATTCCAGTTCCATGG - Intronic
1060520604 9:124291996-124292018 GCCTGGGCCTCCAGGGAGCTGGG - Intronic
1185891085 X:3822614-3822636 GCCTGGGCTTCGAGGTTCCTTGG - Intronic
1185896189 X:3861030-3861052 GCCTGGGCTTCGAGGTTCCTTGG - Intergenic
1185901308 X:3899456-3899478 GCCTGGGCTTCGAGGTTCCTTGG - Intergenic
1185906418 X:3937888-3937910 GCCTGGGCTTTGAGGTTCCTTGG - Intergenic
1187096740 X:16156672-16156694 GCCTAGGCTTTCATGGGCCTAGG + Intergenic
1187719748 X:22138375-22138397 GCGGGGGCCTTCAGGCTCCTAGG + Intronic
1189372455 X:40439690-40439712 GCCTGAGAATCCTGGGTCCTGGG + Intergenic
1193485411 X:82080440-82080462 CTCTGGGGATTCAGGGTCATGGG - Intergenic
1195110362 X:101641759-101641781 ACGTGGCCATTCAGGGTCCCAGG - Intergenic
1196735345 X:118976830-118976852 GGCTGGGCAGGCAGGGCCCTGGG + Intronic
1197078210 X:122378429-122378451 TCCTGGGTATTCAGGGCCCAGGG + Intergenic