ID: 969930472

View in Genome Browser
Species Human (GRCh38)
Location 4:10626092-10626114
Sequence AACCCAGGTCTCCCTGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969930460_969930472 22 Left 969930460 4:10626047-10626069 CCTTCACTCGTGCACTTTGACTG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 969930472 4:10626092-10626114 AACCCAGGTCTCCCTGGCTGGGG 0: 1
1: 0
2: 3
3: 44
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969930472 Original CRISPR AACCCAGGTCTCCCTGGCTG GGG Intronic
900805229 1:4763220-4763242 ATTCCAGATGTCCCTGGCTGAGG + Intronic
901774806 1:11553195-11553217 AGCCCAGACTTCCCTGGCTGTGG - Intergenic
903213649 1:21831684-21831706 CACCCAGGGCTCCCTGATTGTGG - Exonic
903372269 1:22844347-22844369 AGCCCTGCTCTTCCTGGCTGAGG - Intronic
903796091 1:25929890-25929912 AATGCAGGGCTCCCTGGCTGTGG + Intergenic
903867774 1:26411302-26411324 TACTCGGGTCTCCCTGCCTGGGG + Intronic
903938602 1:26913505-26913527 ACCCCAGCCCTCCCTGGCTGCGG - Exonic
904131403 1:28278250-28278272 AACCCAGCTCTGCCTAGCTCAGG - Intronic
904425161 1:30418132-30418154 AACCCAGCTCTGCCTGGCTGGGG - Intergenic
904475525 1:30762310-30762332 ACCCCTGGACTGCCTGGCTGAGG - Intergenic
904747110 1:32718122-32718144 AACCCAGGCCTTTCTGGCTCTGG + Intergenic
905126210 1:35717968-35717990 AAGGCGGGGCTCCCTGGCTGGGG - Intronic
905232401 1:36522367-36522389 AACCCAGGTCTCCAGAGCTAAGG - Intergenic
905250332 1:36644203-36644225 TGCCCAGGCCTCCCTGGCTCAGG - Intergenic
905542706 1:38772837-38772859 ACCCCAGCTCTGCCAGGCTGAGG + Intergenic
906165102 1:43680244-43680266 ACACCAGGTCTCCCTCCCTGAGG + Intronic
906705905 1:47895156-47895178 AACTCAGGTCTTCCTCCCTGTGG - Intronic
907496909 1:54851441-54851463 CACCTAGGTGTCCCAGGCTGAGG + Exonic
907857691 1:58319967-58319989 AAGACAGGTTTCCATGGCTGAGG + Intronic
908130223 1:61067956-61067978 AACCCAGGTCTGTGTGGCAGTGG + Intronic
912626863 1:111212685-111212707 TTCCCTGGCCTCCCTGGCTGGGG + Intronic
912712905 1:111962253-111962275 AACCCAGGTCTGCCTGCCTTTGG + Intronic
915316115 1:155030036-155030058 AGCCCTGGCCTCCCTGGCTTGGG + Intronic
915936090 1:160091168-160091190 AACCCAGGTGTCCCCTCCTGGGG + Intergenic
916691461 1:167194019-167194041 CACTCTGGTCTCCCAGGCTGAGG + Intergenic
918407147 1:184222539-184222561 AACCCAGGGCACCAAGGCTGAGG - Intergenic
920061354 1:203229054-203229076 ACCCTAGGTCTCCAAGGCTGTGG - Intronic
922030511 1:221793236-221793258 AGCCCAGGCATCACTGGCTGAGG + Intergenic
922586524 1:226738008-226738030 GACTCAGCTCTCCCGGGCTGAGG + Intronic
922686895 1:227646654-227646676 AAACCTGGTCTCCCTGGGTGAGG + Exonic
923137938 1:231134649-231134671 AACCCTGGGCTGCTTGGCTGAGG + Intergenic
923207937 1:231776590-231776612 TGCCCAGGGCTCCCTGGCGGGGG + Intronic
923676002 1:236081341-236081363 AGCCCAGTTGTCCCTGTCTGCGG - Intergenic
923888309 1:238182034-238182056 CACTCAGTTCTCCCTTGCTGAGG + Intergenic
924785967 1:247200061-247200083 AAACCTGGTCTCCCTGGGTGAGG - Intergenic
1063593226 10:7411409-7411431 AACTCCCGTTTCCCTGGCTGCGG + Exonic
1064035167 10:11908652-11908674 AAGCCAGGTCCACCTGGCAGGGG + Intergenic
1064164509 10:12974660-12974682 AGCCTGGGTCTTCCTGGCTGTGG - Intronic
1064464009 10:15561861-15561883 CTCACAGTTCTCCCTGGCTGGGG + Intronic
1065323065 10:24526611-24526633 AACCCAGGCCTCCATACCTGTGG - Intronic
1067099185 10:43322436-43322458 AACCAAGGACTCTCTGTCTGTGG - Intergenic
1067223617 10:44361518-44361540 AGCCCTGGTCTCCTTGTCTGTGG - Intergenic
1067527922 10:47049506-47049528 AACCCAGGACCACCAGGCTGTGG - Intergenic
1067582641 10:47455361-47455383 AATCCTGGTTTCCCTGGATGAGG + Intergenic
1069690744 10:70350238-70350260 AGCCCAGGTGTCAGTGGCTGGGG - Intronic
1069995704 10:72340944-72340966 ACCCCAGGGATACCTGGCTGTGG + Intronic
1070187085 10:74074935-74074957 TCCCCAACTCTCCCTGGCTGGGG + Intronic
1070395577 10:76009017-76009039 AACCCAGGTCTCCTGAGCAGTGG + Intronic
1071449453 10:85780346-85780368 AACCCAGGCCTACCTGGAGGAGG + Intronic
1073929141 10:108554568-108554590 AACACAGTTCTGCATGGCTGGGG - Intergenic
1074512419 10:114127793-114127815 AACACAGGTCAACGTGGCTGAGG + Intronic
1074693317 10:116026410-116026432 AGCCCAGGTCTTCCAGGGTGAGG + Intergenic
1075438113 10:122460161-122460183 AAGCCAGGGCCTCCTGGCTGCGG - Intergenic
1076663225 10:132069208-132069230 ACCCCAGGTCTTCCTGCCTGAGG + Intergenic
1076695701 10:132246324-132246346 ACCCCAGGCCTGCCTGTCTGGGG - Intronic
1076715305 10:132361030-132361052 CTCCCAGGTCTCCCTGGTTCTGG + Intronic
1077103861 11:833512-833534 GTCCCAGGTCCCCCTGACTGGGG + Intronic
1078323519 11:10358587-10358609 AACCCAGGTCCTCTTGGCTTGGG - Intronic
1079088534 11:17464405-17464427 AGCCCAGGTGTATCTGGCTGCGG - Intronic
1079452272 11:20607206-20607228 AAGGCAGGTCTCCCTCCCTGGGG - Intronic
1081858614 11:46319311-46319333 AACCCAGGTCTGCCTGGCCCTGG - Intronic
1082734133 11:56837896-56837918 AACTCAGTTCTGCATGGCTGAGG + Intergenic
1083403790 11:62442939-62442961 GAGCCAGGTCTCCCAGGCTTAGG - Intronic
1083925183 11:65801732-65801754 ACCCCAGCTCTCCCAGGCAGAGG + Intergenic
1084003634 11:66312288-66312310 CACCCAGAGCGCCCTGGCTGCGG - Intergenic
1084406910 11:68979480-68979502 GACCCGGATCTCGCTGGCTGTGG - Intergenic
1084468927 11:69343837-69343859 AATCCAGGCCCCTCTGGCTGTGG + Intronic
1084523677 11:69682820-69682842 AACCCAGGTCTCCTGCGCTAGGG - Intergenic
1085399835 11:76229353-76229375 ATCACAGGCCTCCCTGGCTCAGG + Intergenic
1085707956 11:78803480-78803502 AACCCAGGTCTGTCTGACTCAGG + Intronic
1086374447 11:86186028-86186050 AACTCAGGTCTAGCTGGCCGTGG - Intergenic
1086405814 11:86498073-86498095 AGCCCAGGTCTCCCAGGCCCAGG + Exonic
1088015533 11:105054335-105054357 ATCTCAGGTCTCCCAGGCAGAGG - Intronic
1089146192 11:116331120-116331142 AACCCAGGTCTCCGGAGATGGGG + Intergenic
1089313375 11:117574484-117574506 AACCCATGGCTCTCTGGCAGAGG - Intronic
1089842186 11:121427964-121427986 ATTCCAGGGCTCCCTAGCTGTGG - Intergenic
1090388997 11:126375090-126375112 AGGCCAGGTCTCCCGGGCTGCGG - Intronic
1090392246 11:126396338-126396360 AGGCCAGGTCTCCCGGGCTGCGG - Intronic
1091331551 11:134735188-134735210 ACCCCAGTTCTCCATCGCTGCGG - Intergenic
1091395628 12:152774-152796 AAGCCTGCTCTCCCTAGCTGTGG + Intronic
1091644888 12:2265801-2265823 CACCCAGCTCTCCCTCTCTGTGG - Intronic
1091752490 12:3031571-3031593 GACAGAGGTCACCCTGGCTGGGG - Intronic
1092915126 12:13182557-13182579 ACCCCATGTCCCCCTGGGTGAGG - Intergenic
1094026174 12:25961536-25961558 AACCCAAGTCTGGCTGGCAGTGG - Intronic
1095518807 12:43037608-43037630 AACCCAGATCGCAGTGGCTGAGG - Intergenic
1095965424 12:47864071-47864093 AACCCAGGCCCTCCTAGCTGTGG - Intronic
1096156833 12:49345737-49345759 TACCCGGGTCTCCCCGGCGGGGG - Intergenic
1097263988 12:57735715-57735737 AGCCCTGGTCTCCCTGTCTGGGG - Intronic
1098010555 12:66046221-66046243 AACACAGGACTCCCTGGGTGGGG - Intergenic
1101449894 12:104766557-104766579 GACCCAGTTCTACATGGCTGGGG - Intergenic
1101822148 12:108192377-108192399 AACCCAGGTCTGTTTGCCTGTGG + Intronic
1101875933 12:108597104-108597126 TGCCCAGGACTCCCTGCCTGGGG + Intronic
1102171404 12:110845389-110845411 AACCCAAGGCTCCCTGTCTCTGG - Intergenic
1102521763 12:113481794-113481816 AACCCAGATCTCATTGGCTTTGG + Intergenic
1102927377 12:116836399-116836421 AACCCAGGTCTGGCTGACTCCGG - Intronic
1104594620 12:130112674-130112696 CTCCCAGGTCTACATGGCTGGGG + Intergenic
1105426216 13:20297159-20297181 AACCCATGTCTTCCTGTCTCCGG + Intergenic
1105844220 13:24281003-24281025 TACCCATGTCTGTCTGGCTGGGG - Intronic
1107740446 13:43444919-43444941 AACCCAGGTCTCCCTAGCCCAGG - Intronic
1107887825 13:44889155-44889177 AACCCAGGTCTCCCTACCTCTGG + Intergenic
1108682607 13:52792419-52792441 CACCCAGGTCCAGCTGGCTGGGG + Intergenic
1110067278 13:71124619-71124641 TACCAAGGTCTCCATTGCTGTGG - Intergenic
1112414482 13:99192917-99192939 CACCCATGTCTCTCTGCCTGAGG + Intergenic
1112813698 13:103248964-103248986 AACCCATCTGTCCCTGCCTGTGG - Intergenic
1112974790 13:105304120-105304142 AACCCAGGTCACCCTCCTTGAGG + Intergenic
1113488775 13:110676252-110676274 ACCCAAGGTGCCCCTGGCTGTGG + Intronic
1114393780 14:22338273-22338295 CACCCAGGTCTCCCTGGGAGAGG + Intergenic
1115217629 14:31028257-31028279 AACCTGGAGCTCCCTGGCTGAGG + Intronic
1115449721 14:33532582-33532604 AACCCAGACCTCCCTGACTCTGG + Intronic
1115647376 14:35378434-35378456 AACCCAGGAGTTCCAGGCTGCGG + Intergenic
1117670606 14:58102158-58102180 AAACCATGTATCCCTGCCTGAGG - Intronic
1118673580 14:68158059-68158081 AAGCTAGGTCTCCCTGAATGTGG - Intronic
1119401369 14:74364887-74364909 AACCTGGGTGTCACTGGCTGGGG - Intergenic
1119898739 14:78242644-78242666 GTCCCTGGCCTCCCTGGCTGGGG + Intronic
1119920676 14:78443164-78443186 AAACCAGGTATCCCTAGCTCAGG - Intronic
1120689892 14:87580791-87580813 AATCCAGTTCCCTCTGGCTGTGG - Intergenic
1121013604 14:90535411-90535433 TCCCCAGGGCTCCCTGGCTTGGG + Exonic
1121509119 14:94499288-94499310 CAGCCAGGTCTGCCTGGCTCTGG + Intronic
1122037960 14:98962079-98962101 GAGCCAGGTCTGCCAGGCTGGGG - Intergenic
1122937638 14:104967336-104967358 AACACAGGTCTGCTGGGCTGGGG + Intronic
1122985146 14:105208465-105208487 AAAGCAGGTCTCCCGGGATGAGG + Intergenic
1124514003 15:30350696-30350718 AGCCCAAGTCTCTTTGGCTGAGG + Intergenic
1124728918 15:32180069-32180091 AGCCCAAGTCTCTTTGGCTGAGG - Intergenic
1125417945 15:39473145-39473167 AACCCAGTCCTCCCTGGTGGAGG - Intergenic
1125592683 15:40864594-40864616 GTCCCAGGTGTCCCTGGGTGGGG + Intergenic
1125604349 15:40931540-40931562 CATCCAGGGCTCCCTAGCTGTGG + Exonic
1125999297 15:44194687-44194709 TACCCTGCTCTCCCTGGGTGAGG - Intronic
1128218917 15:65953966-65953988 ACCCCAGCTCTCCCTGCCCGGGG - Intronic
1128411797 15:67406700-67406722 AACCTAGGTGTCCCTGGCTATGG - Intronic
1128998443 15:72314036-72314058 CACCCAGGTCTCTCTGACTCAGG + Intronic
1129523493 15:76200081-76200103 AGCCCAGGAGTCCCTGTCTGCGG - Intronic
1129753856 15:78084204-78084226 AGCCCTGGGCTCCCTTGCTGGGG - Intronic
1130573931 15:85073890-85073912 AACCCTGGTCCCCCTGACTGGGG - Intronic
1130925224 15:88380450-88380472 AATCCAGGTCTCTCTAGCTCAGG - Intergenic
1131538516 15:93256785-93256807 AACCCAGGTCTGCCTGATTCAGG - Intergenic
1132101404 15:99025918-99025940 AGCCCTGGTCTGCATGGCTGGGG + Intergenic
1132566255 16:624930-624952 AAACCTGCTCTGCCTGGCTGGGG + Intronic
1134021797 16:10926156-10926178 CACCCAGCTCTCACTTGCTGGGG - Exonic
1134107074 16:11492849-11492871 CTCCCAGGTCCCCCTGGCTCTGG - Intronic
1135023254 16:18980073-18980095 AACCGAGGTCTCTCTGGCTCAGG + Intergenic
1135074936 16:19384947-19384969 AACTGAGGTCTCCCTGGCTCAGG - Intergenic
1135481056 16:22820966-22820988 AAGCCAGGTCTCCCAGGCAGAGG - Intronic
1136108955 16:28052753-28052775 AGCCCAGGCTGCCCTGGCTGAGG + Intronic
1136657844 16:31722736-31722758 AAACCTGGTCTCTCTGGGTGAGG + Exonic
1136674134 16:31884608-31884630 AAACCTGGTCTCTCTGGGTGAGG + Exonic
1137406629 16:48194135-48194157 AACCCAGGGCTCTCTGACTTTGG - Intronic
1137482861 16:48866849-48866871 CATCCAGGTCTCCTTGGCTCTGG + Intergenic
1137991318 16:53159202-53159224 AACCCAGGAGTTCCAGGCTGAGG + Intronic
1140205530 16:72929577-72929599 AACACAGTTTTTCCTGGCTGAGG - Intronic
1140471669 16:75218898-75218920 GGCTCAGGCCTCCCTGGCTGGGG + Intergenic
1141872045 16:86793798-86793820 AGCCCAGGCTTCCCTGGCAGTGG + Intergenic
1142194395 16:88732834-88732856 AGCCCCCGTGTCCCTGGCTGGGG - Intronic
1142976343 17:3646913-3646935 AACCCAGCTCACCCTGGCACTGG - Intronic
1143017098 17:3896686-3896708 AATCCTGGGCTCCCTGCCTGTGG - Exonic
1143599975 17:7938708-7938730 AACCCAGGTCTACCTGGCTCTGG + Intronic
1145198401 17:20916969-20916991 AGCCCTGGTCTGGCTGGCTGTGG + Intergenic
1146743252 17:35305107-35305129 CACCAAGGTCTGCCTGTCTGAGG - Intergenic
1146910626 17:36646353-36646375 AACCCAGGTATCCGTGTCTGTGG - Intergenic
1148238388 17:45983969-45983991 CTCCCAGGCCTCCCAGGCTGCGG + Intronic
1148858028 17:50589769-50589791 AACCCGGGTGTCCCGGGCTCAGG + Intronic
1149008647 17:51832084-51832106 AACCCAGGTCTCTCTGACAATGG - Intronic
1150114345 17:62532232-62532254 AACCAACGTCTCCCTGGGGGGGG - Intronic
1150580191 17:66466357-66466379 AACGCAGGGCTCCCTGGGTCTGG - Intronic
1150873420 17:68941634-68941656 AACCCTAGTCTCCATGACTGGGG + Intronic
1150925572 17:69528434-69528456 AACCCAGGTCAACCTGGCAGAGG - Intronic
1150929338 17:69567296-69567318 AACACAGGTCCACCAGGCTGAGG - Intergenic
1151443332 17:74147802-74147824 AACCCAGGTTTCCCTAAATGAGG - Intergenic
1151619772 17:75238616-75238638 AACCCAGGGGTCCCAGCCTGAGG - Intronic
1152214564 17:79024730-79024752 GTCCCGGGTCTCCCTGACTGTGG + Intronic
1157418750 18:47527255-47527277 AACCCATTTCTGCCTGGCAGGGG + Intergenic
1157577586 18:48754040-48754062 AGCCTAGGTCTCCATTGCTGGGG + Intronic
1157876564 18:51279353-51279375 AACCCTGGTCACCCAGGCTCAGG - Intergenic
1158203716 18:54967776-54967798 AACTCAGTTCTGCATGGCTGTGG + Intergenic
1158889248 18:61858176-61858198 CACCCAGGTCCCACTGACTGTGG + Intronic
1159998467 18:74992044-74992066 ACCTCAGTTCTCACTGGCTGTGG - Intronic
1160086015 18:75778239-75778261 ACCCAAGGTCTCCCATGCTGTGG + Intergenic
1160503886 18:79416775-79416797 AAGCCACGTCGCCCTGGCTCTGG + Intronic
1161195723 19:2985355-2985377 TACCTAGGTCTCCCTAGGTGAGG - Intronic
1161847578 19:6720526-6720548 AACCCACCTCCCCCTGGCTCTGG - Exonic
1162524958 19:11201690-11201712 CTCCCAGGTCTCCCTGGGTCTGG + Intronic
1163108418 19:15141602-15141624 AAACCAGGGCTCCCAGGCAGAGG + Intergenic
1163827770 19:19533174-19533196 AACCCAGGTGTGTCTGGCTCTGG + Intronic
1163984637 19:20934134-20934156 AAACCTGGTCTTCCTGGGTGAGG + Exonic
1164102776 19:22072919-22072941 AAACCTGGTCTTCCTGGGTGAGG + Exonic
1164124854 19:22303868-22303890 AAACCTGGTCTTCCTGGGTGAGG + Exonic
1164175366 19:22769192-22769214 AAACCTGGTCTTCCTGGGTGAGG - Exonic
1164214625 19:23134190-23134212 AAACCTGGTCTTCCTGGGTGAGG + Exonic
1164668592 19:30059957-30059979 GACCCAGCTCTCCCGGGATGCGG + Intergenic
1165148790 19:33749222-33749244 AACTCAGTTGTCCCTGGCTCCGG - Intronic
1165149434 19:33752146-33752168 ATCCCAGGGCTCCCGGGCTCAGG - Intronic
1165313444 19:35041541-35041563 GACCCAGGTGTGCCTGTCTGCGG - Intronic
1165394619 19:35557667-35557689 CGCCCAGGCCTCCCAGGCTGAGG + Exonic
1166198382 19:41220799-41220821 GACCCAGGTGCCCCTGGGTGAGG + Exonic
1166720295 19:44992546-44992568 CACCCAGGCCCACCTGGCTGTGG + Intronic
1166861624 19:45814942-45814964 GCCCCAGGTCTTCCAGGCTGAGG - Exonic
1167279752 19:48559999-48560021 AACCCAGGACTGCCTTCCTGTGG - Intronic
1167437208 19:49486409-49486431 GCCCCAGGTCTCCTTGGCTATGG + Intergenic
1167864577 19:52314263-52314285 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1167875146 19:52406017-52406039 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1167895306 19:52576005-52576027 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1167900597 19:52618930-52618952 GAACCTGGTCTCCCTGGGTGAGG - Intronic
1167923917 19:52808001-52808023 GAACCTGGTCTCCCTGGGTGAGG - Exonic
1167933546 19:52888121-52888143 GAACCTGGTCTCCCTGGGTGAGG - Exonic
1167936767 19:52915190-52915212 GAACCTGGTCTCCCTGGGTGAGG - Intergenic
1167962363 19:53116307-53116329 GAACCTGGTCTCCCTGGGTGAGG - Exonic
1167969117 19:53175439-53175461 GAACCTGGTCTCCCTGGGTGAGG - Exonic
1167973425 19:53204126-53204148 GAACCTGGTCTCCCTGGGTGAGG + Intergenic
1167989441 19:53345616-53345638 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1167992916 19:53375880-53375902 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1167995917 19:53402175-53402197 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1168001457 19:53449622-53449644 GAACCTGGTCTCCCTGGGTGAGG + Exonic
1168005883 19:53486742-53486764 GAACCTGGTCTCCCTGGGTGAGG + Exonic
925469356 2:4142528-4142550 GACCCAGTTCGCCCTGGCTCAGG - Intergenic
925831002 2:7895484-7895506 AGTCCACGCCTCCCTGGCTGTGG + Intergenic
925985025 2:9207739-9207761 CAGCCAGGCCGCCCTGGCTGAGG - Intronic
926045061 2:9704124-9704146 ACCCCAGCTTTCTCTGGCTGTGG + Intergenic
926086471 2:10023306-10023328 CACCTGGCTCTCCCTGGCTGTGG + Intergenic
926253318 2:11168709-11168731 CTCACAGGTCTCCCTGCCTGGGG + Intronic
926694950 2:15764693-15764715 AACCCACTTCTCCCCTGCTGGGG + Intergenic
929113103 2:38421870-38421892 AACCCTGGTAGCACTGGCTGGGG + Intergenic
932331957 2:70902786-70902808 AGCCCATCTCTGCCTGGCTGTGG - Intronic
932448176 2:71793448-71793470 AACCCAAGTCTCCCTGTCCCAGG + Intergenic
932479879 2:72032761-72032783 AACCCGGGCCTCCCTGACTTGGG - Intergenic
933602618 2:84348225-84348247 AAGCATGGTTTCCCTGGCTGGGG + Intergenic
934608672 2:95718150-95718172 AATCCAGGACTTCCTGGCTCTGG - Intergenic
934662981 2:96153010-96153032 TCCCCAGCTCTCTCTGGCTGTGG - Intergenic
936372370 2:111912831-111912853 AACCCAGGGCTCAGTAGCTGGGG + Intronic
936968380 2:118149818-118149840 CACTCTGGTCTCCTTGGCTGGGG + Intergenic
937422695 2:121771674-121771696 CTCCCAGGTGTCCCTGCCTGTGG - Intergenic
938371242 2:130769675-130769697 ATCCCAGGTGGCCCTGGCTCTGG - Intergenic
939296002 2:140264823-140264845 AACTCAGGTATCCCTGTGTGTGG - Intronic
940337616 2:152545669-152545691 ATCCCAGGCCTCCCTTGATGGGG + Intronic
941874371 2:170418194-170418216 AGCCCTGGTTTCCATGGCTGAGG + Intronic
942045633 2:172097703-172097725 AACCCAGGCCTCCCTAGCCTGGG + Intergenic
942061151 2:172229763-172229785 AAACCAGGTCTGTCTGGCTATGG - Intergenic
942779220 2:179621583-179621605 AAACCAGCTCTCACTGGCTTGGG - Intronic
943526176 2:189020482-189020504 GACCCAGGTCTCCCACTCTGTGG + Intergenic
945722293 2:213432920-213432942 AATCCTGGTATCCCTGGCAGTGG - Intronic
947566390 2:231196618-231196640 AACCCAGGTCTCCGTGTCTCTGG - Intergenic
947945416 2:234097737-234097759 AACCCAGGAGTTCCAGGCTGTGG - Intergenic
948685339 2:239666356-239666378 AACCCAGGACTCCAAGTCTGAGG - Intergenic
948793293 2:240390112-240390134 ATCCCAGTTCCCCTTGGCTGGGG + Intergenic
948896918 2:240931885-240931907 ACCCCAGGTCCCCCTTCCTGTGG - Intronic
1170107211 20:12764399-12764421 CACCAAGGTCCCCCTGGCTGTGG - Intergenic
1170209997 20:13838785-13838807 AAGACAGGCCTCCCTGCCTGTGG - Intergenic
1170981644 20:21219782-21219804 AACGGAGGTCTTCTTGGCTGGGG + Intronic
1171439267 20:25147851-25147873 AGCCCTGGTCCCCCAGGCTGTGG - Intergenic
1172127217 20:32631885-32631907 AAACCAGCTCTCTCTGGCTCTGG - Intergenic
1172270765 20:33654564-33654586 AACCCCAGTCACCCTGTCTGTGG - Intergenic
1172387043 20:34541332-34541354 AACCCAAGTCCCCATGTCTGAGG - Intergenic
1172768843 20:37365397-37365419 CACCCAGGTCTCCTTGCCAGAGG + Intronic
1172871092 20:38136024-38136046 AAGCCAGGTCTTCCTGGCCTCGG + Intronic
1172980309 20:38936647-38936669 AACCCAGGTCTCTGTGACTCCGG - Intronic
1173618117 20:44416037-44416059 CACCCAAACCTCCCTGGCTGGGG + Intronic
1173888483 20:46482465-46482487 AACTCAGGTCTGCCTGATTGAGG - Intergenic
1174277267 20:49413194-49413216 AACCCAGTTCTCTCTGCCCGTGG - Intronic
1174701777 20:52616692-52616714 GGCTCAGATCTCCCTGGCTGGGG + Intergenic
1175986956 20:62768796-62768818 AGCTCAGGTCTCAATGGCTGTGG - Intergenic
1176114352 20:63424690-63424712 AACCCTGGGCTCACTGACTGTGG - Intronic
1178374601 21:32056466-32056488 AACTCAGTTCTCTCTGTCTGGGG + Intergenic
1178608395 21:34058629-34058651 AACCCATGGCTCCAAGGCTGAGG + Intergenic
1179457467 21:41508772-41508794 CAGCCACGTCTTCCTGGCTGAGG - Intronic
1180983542 22:19890950-19890972 CACCCCAGTCTCTCTGGCTGTGG + Intronic
1181744745 22:24948214-24948236 AACTCAGGTCACACTGACTGAGG - Intergenic
1182742948 22:32582127-32582149 AAATCAGGCTTCCCTGGCTGGGG + Intronic
1182760316 22:32717405-32717427 ACCCCAGATCACCATGGCTGGGG - Intronic
1183285257 22:36958613-36958635 AACCCGGGTCTGTCTGGCTCTGG - Intergenic
1184737800 22:46409471-46409493 ATCCCTGGGCTCCGTGGCTGGGG + Intronic
1185392361 22:50569495-50569517 AACACAGGTGTCTTTGGCTGGGG - Intronic
949812433 3:8020572-8020594 AGAGCAGGCCTCCCTGGCTGGGG + Intergenic
952382463 3:32816273-32816295 AACCGAGATCTCCCGGGCAGTGG + Intergenic
953347622 3:42189299-42189321 AACACATGCCTCCCTGGCTGGGG + Intronic
954452885 3:50581163-50581185 AACCCATGTGTCCCTGGTTGGGG + Exonic
954455790 3:50599186-50599208 CACCCAGGTCAGGCTGGCTGTGG - Intergenic
954538139 3:51376510-51376532 AACTCAGATCTCCGTGTCTGAGG - Intronic
954709895 3:52500340-52500362 AACCCAGGGCATCCTGGCTGGGG - Intronic
954809798 3:53240905-53240927 ATCCCAGAGCACCCTGGCTGAGG + Intronic
955688862 3:61570993-61571015 AACCCAGGTCTCTGTGGTTTTGG - Intronic
957916460 3:86693721-86693743 CACCAAGGTCTGCCTGTCTGAGG + Intergenic
960157899 3:114316762-114316784 AACCCAGGTTTCTCTTGCTTGGG - Intergenic
962603237 3:137011209-137011231 AGCCCAGGGCTGCCTGGTTGGGG + Intergenic
963655878 3:148049541-148049563 AACCCAGGCCCCACTGGCAGAGG + Intergenic
964223389 3:154370366-154370388 CACCAAGGTCTGCCTGTCTGAGG - Intronic
964635263 3:158851331-158851353 ATCCCAGGACTTGCTGGCTGAGG - Intergenic
964916898 3:161850731-161850753 AACCAAGGTCTGCCTGTCTGAGG + Intergenic
966148189 3:176835597-176835619 AACCCAGGTCTCCTTTAGTGTGG - Intergenic
966357753 3:179099911-179099933 CTCCCTGGACTCCCTGGCTGAGG - Intergenic
966784784 3:183613421-183613443 AACCCAGTTCTCTCTGACTCCGG + Intergenic
966863844 3:184245417-184245439 CACCCAGCCCTCCCAGGCTGGGG + Intronic
967215558 3:187206990-187207012 CACCCAGCTCTTCCAGGCTGGGG + Intergenic
968047179 3:195630998-195631020 CACACAGGTCTCTCTGTCTGTGG + Intergenic
968047390 3:195631829-195631851 TACACAGGTCTCGCTGTCTGTGG - Intergenic
968307223 3:197658095-197658117 CACACAGGTCTCGCTGTCTGTGG + Intergenic
968307468 3:197659046-197659068 CACACAGGTCTCTCTGTCTGTGG - Intergenic
968377925 4:59540-59562 GAACCTGGTCTCCCTGGGTGAGG + Exonic
968385289 4:130898-130920 AAACCTGGTCTCCCTGGGTAAGG + Exonic
968394253 4:218762-218784 AAACCTGGTCTCCCTGGGTGAGG + Intergenic
968406470 4:343892-343914 GAACCTGGTCTCCCTGGGTGAGG + Exonic
968419549 4:472569-472591 AAACCTGGTCTCCCTAGGTGAGG - Exonic
968900117 4:3426992-3427014 GGCCCAGGTCTCCCTGGGTGGGG - Intronic
969102045 4:4776690-4776712 AACCCAGATCTGCCTGAGTGTGG + Intergenic
969315738 4:6380538-6380560 AACGCAGGTCACCCAGGCAGAGG + Intronic
969332026 4:6479424-6479446 AACCCAGGTCGCCATGCCTCTGG + Intronic
969378118 4:6776541-6776563 CACCAAGGTCTCCCAGTCTGAGG + Intergenic
969660611 4:8525370-8525392 CACCCTGGTCTCCCTGGCATGGG + Intergenic
969930472 4:10626092-10626114 AACCCAGGTCTCCCTGGCTGGGG + Intronic
971451616 4:26806274-26806296 AGGCCTGGTCTCCCTGCCTGTGG - Intergenic
971627326 4:28938687-28938709 AACCCAGTTCTCCCTGGCAAGGG + Intergenic
971884357 4:32423988-32424010 AGCTCAGGCCTCCCTGGATGGGG + Intergenic
972703365 4:41515723-41515745 AACCCAGGTCTTTCTGTCTCTGG + Intronic
973551393 4:52038653-52038675 GACCAAGGTCTCCTTGGCTAGGG + Intergenic
975000800 4:69222057-69222079 CACCAAGGTCTGCCTGTCTGAGG + Intergenic
975004647 4:69270211-69270233 CACCAAGGTCTGCCTGTCTGAGG - Intergenic
975013067 4:69379191-69379213 CACCAAGGTCTGCCTGTCTGAGG - Intronic
982685855 4:158488183-158488205 AAACCAGGTGTCCATGGCAGAGG + Intronic
983602828 4:169549223-169549245 AACCCTGGTGTTCCTGGGTGAGG + Intronic
985491028 5:179567-179589 TGCCCAGGTCTCTCTGCCTGGGG - Intronic
985529297 5:424373-424395 AACCCATGTGTCCCTGGTGGGGG + Intronic
985639116 5:1055010-1055032 ACCCCAGCACTCACTGGCTGTGG - Intronic
985744219 5:1637335-1637357 CACACAGGTCTCGCTGTCTGTGG + Intergenic
985744424 5:1638131-1638153 CACACAGGTCTCCCTGTCTGTGG - Intergenic
986017976 5:3774788-3774810 TCCCCAGGACTCGCTGGCTGAGG + Intergenic
986290583 5:6396247-6396269 CACCCCGGTCACCCTGGCAGAGG - Intergenic
987910782 5:24141301-24141323 AGCCCAGATTTTCCTGGCTGTGG + Intronic
990345550 5:54867314-54867336 AACCCAGGACTCCAAGGTTGAGG + Intergenic
990560995 5:56982683-56982705 CACCCAGTTCTACATGGCTGGGG - Intergenic
992872623 5:81022232-81022254 CTCCCAGGTCTCTCTTGCTGGGG + Intronic
995526468 5:113054520-113054542 TACGCAGGTGTCCCAGGCTGTGG + Intronic
997887204 5:137640698-137640720 AACCCAAGTCTACCTGACAGAGG + Intronic
998006650 5:138661632-138661654 AGTCCAGGTTTCCCTGGGTGTGG - Intronic
998374999 5:141684663-141684685 AAGCCAGGTCTCCCTCTCTGTGG - Intergenic
998508039 5:142687806-142687828 AAACCAGGTCTCCCTGCTTTAGG + Intronic
998746840 5:145270918-145270940 AAGCCAGTTCCCCATGGCTGGGG + Intergenic
1000052541 5:157575450-157575472 AAGCCCGGGCTCCCAGGCTGGGG + Intronic
1000116800 5:158161196-158161218 AACACAGGTCTCTCTTGTTGAGG - Intergenic
1000338980 5:160262429-160262451 GACCCAGCACTGCCTGGCTGTGG - Intronic
1001407314 5:171485230-171485252 AACCCAGGTCTCTTTGCCTCTGG + Intergenic
1001605352 5:172955876-172955898 TACCCAGGTCTGCCTGACTCTGG + Intergenic
1001684305 5:173581920-173581942 AGCCCAGGGCTCCTGGGCTGAGG - Intergenic
1002943510 6:1739088-1739110 GACCCAGGTCTTCATGCCTGTGG - Intronic
1002968984 6:1995118-1995140 GCCCCATTTCTCCCTGGCTGTGG - Intronic
1004477345 6:15986165-15986187 AACCCAAGTCTGCCTGTCTCTGG - Intergenic
1005724878 6:28638808-28638830 ATTCGTGGTCTCCCTGGCTGAGG + Intergenic
1006228151 6:32558253-32558275 CATCCAGGGCTCCCTGGGTGGGG + Intronic
1006317004 6:33297270-33297292 ACCCCAGGTCTCCCCCACTGGGG + Intronic
1006516429 6:34548152-34548174 AGTCCACGTCACCCTGGCTGTGG - Intronic
1007517943 6:42428497-42428519 ACCCCAGGTCTCCAGAGCTGAGG + Intronic
1013274679 6:108572898-108572920 AACCCAGGGCTCTCTGACTTGGG + Intronic
1014358562 6:120444738-120444760 ATCCCACCTCTCCCTGGATGGGG + Intergenic
1016982141 6:149863681-149863703 CACCAAGGACTCCCTGGCGGCGG - Exonic
1017511035 6:155114702-155114724 AACAAAGGTTTCCGTGGCTGGGG - Intronic
1019115980 6:169763067-169763089 ACCCCCGGTCGCCCTGTCTGAGG + Intronic
1019193740 6:170269010-170269032 AGACCAGGTCACACTGGCTGGGG + Intergenic
1019279534 7:192944-192966 ACCCCTGGGCTCCCCGGCTGAGG + Intergenic
1020072587 7:5237260-5237282 AACCCAGCTCTCCCAGGGTGGGG + Intergenic
1020140128 7:5607316-5607338 AACCCAGGTCGCCCTGACTGTGG - Intergenic
1021360817 7:19709667-19709689 ACCGCAGGACTCCCTGCCTGTGG + Intergenic
1024586224 7:50844273-50844295 ATACCTGGTCTCCCAGGCTGGGG - Intergenic
1024980369 7:55153114-55153136 CACACAGGTCTTGCTGGCTGGGG + Intronic
1025170720 7:56754160-56754182 AACTCAGTTCTACATGGCTGGGG - Intergenic
1025222491 7:57126586-57126608 AAACCTGGTCTCCCTGGGTGAGG - Exonic
1025238164 7:57248935-57248957 AAACCTGGTCTACCTGGGTGAGG - Intergenic
1025266442 7:57462570-57462592 AAACCTGGTCTCCCTGGGTGAGG + Exonic
1025633278 7:63298260-63298282 AAACTTGGTCTCCCTGGGTGAGG - Intergenic
1025649418 7:63449929-63449951 AAACTTGGTCTCCCTGGGTGAGG + Intergenic
1025701163 7:63821539-63821561 AACTCAGTTCTACGTGGCTGGGG + Intergenic
1025720379 7:64005722-64005744 AAACCTGGTCTCCCTGGGTGAGG + Intergenic
1025742798 7:64213202-64213224 AAACCTGTTCTCCCTGGGTGAGG + Intronic
1025747853 7:64260331-64260353 AAACCTGGTCTCCCTGGGTGAGG + Exonic
1025774165 7:64544300-64544322 AAACCTGGTCTTCCTGGGTGAGG - Exonic
1025816497 7:64917691-64917713 AAACCTGGTCTTCCTGGGTGAGG + Exonic
1026338824 7:69418112-69418134 AATCCAAGTCTTCCTGGCTCTGG - Intergenic
1026592750 7:71711035-71711057 AACCCAGGTCTCCCTGCCCCGGG + Intronic
1026822027 7:73556464-73556486 AACCCAGGTCTGGCTAGGTGAGG - Intronic
1026833424 7:73623528-73623550 AACCCAGGCCTCCCGGGCACCGG + Intronic
1026887155 7:73957402-73957424 CACCCATGTCACCCAGGCTGGGG - Intergenic
1028033493 7:85949548-85949570 GACCCAGGGCATCCTGGCTGTGG - Intergenic
1029111376 7:98214506-98214528 AGCCCAGGGCTCCCCTGCTGTGG + Intergenic
1030929592 7:115505665-115505687 ATCCCATGTCTCCTTTGCTGCGG + Intergenic
1031918251 7:127582973-127582995 AAGCCAGGTGACCCTGGATGTGG - Exonic
1032254943 7:130289680-130289702 AAGCCAGGTCTCCTCGGCTGTGG - Exonic
1032269153 7:130387944-130387966 CAGCCACGTCTCCTTGGCTGTGG - Exonic
1032783445 7:135182648-135182670 AGCCCAGGTCTCATGGGCTGGGG + Intergenic
1033372588 7:140724290-140724312 AGCCCAGGTCTCTCTACCTGCGG + Intronic
1033525360 7:142208155-142208177 AACCCATGTCTACCTGACTTGGG + Intronic
1033601142 7:142889113-142889135 AAACCAGTCCTCCCTGCCTGGGG + Intergenic
1035022640 7:155808479-155808501 GACCCGGGTCTCCCTGCCCGGGG - Intronic
1035255049 7:157620872-157620894 AACCCAGGCCTCCCTCCCCGGGG + Intronic
1035405788 7:158596322-158596344 AACCCAGCACTTACTGGCTGTGG - Intergenic
1035624500 8:1060830-1060852 ATCCCAGGCTGCCCTGGCTGTGG - Intergenic
1036288022 8:7462019-7462041 AACCTAGTTCTCCCTGTCTTAGG + Intronic
1036333454 8:7849509-7849531 AACCTAGTTCTCCCTGTCTTAGG - Intronic
1037269576 8:17111879-17111901 GACCCAGTTCTACATGGCTGGGG + Intronic
1037894146 8:22640748-22640770 ACACCTGGTCTCCCTGGCTGGGG + Intronic
1038327583 8:26583946-26583968 AACCAAGGCGGCCCTGGCTGGGG + Exonic
1039503210 8:38032765-38032787 CAGCCAGGTTTCCCTGGCTTAGG - Intronic
1040523525 8:48198275-48198297 AACCCGGGCCTCCCTGGCCTGGG + Intergenic
1041400177 8:57434462-57434484 AGCCCAGGTCTTCTTGACTGGGG + Intergenic
1042161652 8:65903231-65903253 AACCCAGGTCCACCTGACTTTGG - Intergenic
1045344389 8:101281389-101281411 AACACAAGTCTCCCTGCCTGGGG - Intergenic
1045929263 8:107603812-107603834 CACCAAGGTCTGCCTGTCTGAGG + Intergenic
1046010282 8:108538338-108538360 AACACAGGTCTCCTGGGATGCGG - Intergenic
1048063198 8:130941930-130941952 AACCCATGTCTGTCTGACTGTGG + Intronic
1048274505 8:133056062-133056084 AAACCAGGTCTCCCTGGGCAGGG + Intronic
1048460190 8:134615115-134615137 AACCCCACTGTCCCTGGCTGAGG - Intronic
1048876131 8:138838093-138838115 AACCCAGGTGTGGCCGGCTGCGG - Intronic
1049041152 8:140112773-140112795 AACCCAGGTCTGTCTGGTTTGGG + Intronic
1049684567 8:143934169-143934191 CGCTCCGGTCTCCCTGGCTGTGG + Intronic
1050920037 9:11188793-11188815 ACCCCAGGTTACCCTGGCTTGGG + Intergenic
1051386051 9:16510108-16510130 AACAGAGGTCTCCCTGACCGTGG - Intronic
1051692643 9:19732721-19732743 AACCCAGGCCTGCCTGTCTCAGG + Intronic
1052412927 9:28145963-28145985 AACCCAGATCTCCATGTCTTTGG + Intronic
1053414746 9:37940116-37940138 AACCCAGGTCTCCTGGGCATAGG + Intronic
1054835534 9:69672127-69672149 CACCCACCCCTCCCTGGCTGTGG + Intronic
1055005278 9:71498694-71498716 ATCCCTGGTGTCCCTGGATGGGG + Intergenic
1055260955 9:74433011-74433033 AACCCACGTCTCCCTCACTAGGG - Intergenic
1055892088 9:81134374-81134396 AACCCAGGTGTTCGAGGCTGTGG - Intergenic
1057079357 9:92160861-92160883 AACCCAGCTCTCCCTGTTTCTGG + Intergenic
1058117367 9:101099461-101099483 TATCCAGCTCTCCCTGTCTGTGG + Intronic
1061439505 9:130590946-130590968 AACCCAGGTCTGCCTGACTCTGG - Intronic
1061673276 9:132201274-132201296 AGCCCATGTCTCCCTGGAGGTGG + Intronic
1061990196 9:134154582-134154604 CACGCAGGTGTCTCTGGCTGGGG - Intronic
1061999373 9:134208033-134208055 AACCCAGGCCCTCCTGGGTGAGG - Intergenic
1062000207 9:134212055-134212077 ACCCCAAGTCCACCTGGCTGGGG + Intergenic
1062010423 9:134264002-134264024 GACCCTGGTCTGCCTGGCTGGGG + Intergenic
1062452154 9:136620316-136620338 ACCCCAGGTCAGCCTGGCGGAGG - Intergenic
1203571313 Un_KI270744v1:134707-134729 GAACCTGGTCTCCCTGGGTGAGG - Intergenic
1186513946 X:10152055-10152077 AACCCAGCTCTCCAAGGGTGGGG - Intergenic
1188544357 X:31287124-31287146 AACCCAGGCCTCCTAGGCTGTGG - Intronic
1189090929 X:38081890-38081912 TACCCAGAACTCCCTGCCTGAGG - Intronic
1189242576 X:39537187-39537209 AACCTGGGTCTGCCTGGCTCCGG + Intergenic
1190927556 X:54922685-54922707 AACCAAGGACTCCCTGGCCATGG + Exonic
1192259404 X:69495478-69495500 AACCTGGGTTTCCCTGGCTTGGG - Intergenic
1192362472 X:70448454-70448476 ACCACAGTTCTCCCTGACTGGGG - Intronic
1198131012 X:133695048-133695070 AAGCCAGCTCTGCATGGCTGGGG + Intronic
1198275197 X:135093401-135093423 AATCCAGGTGTGCCTGGGTGCGG - Intergenic
1199358549 X:146889666-146889688 AACCCAGGACTCGATGGCTTTGG + Intergenic
1199660940 X:150050538-150050560 GACTCAGGTCTCCATTGCTGGGG + Intergenic