ID: 969930472

View in Genome Browser
Species Human (GRCh38)
Location 4:10626092-10626114
Sequence AACCCAGGTCTCCCTGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969930460_969930472 22 Left 969930460 4:10626047-10626069 CCTTCACTCGTGCACTTTGACTG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 969930472 4:10626092-10626114 AACCCAGGTCTCCCTGGCTGGGG 0: 1
1: 0
2: 3
3: 44
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969930472 Original CRISPR AACCCAGGTCTCCCTGGCTG GGG Intronic