ID: 969931645

View in Genome Browser
Species Human (GRCh38)
Location 4:10636667-10636689
Sequence CAGCTCTCATACCGTGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969931644_969931645 -9 Left 969931644 4:10636653-10636675 CCAAGGCATGGAGACAGCTCTCA 0: 1
1: 0
2: 1
3: 16
4: 233
Right 969931645 4:10636667-10636689 CAGCTCTCATACCGTGCACTTGG 0: 1
1: 0
2: 1
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969931645 Original CRISPR CAGCTCTCATACCGTGCACT TGG Intronic
900720294 1:4171660-4171682 CAGCTCTCATGCCTGGCACATGG + Intergenic
901092805 1:6653508-6653530 CAGCTCTCATCCTGAGCCCTGGG - Intronic
902122272 1:14176448-14176470 CATGTCTCATACCCTGCCCTGGG - Intergenic
903594597 1:24484466-24484488 CAGCTCTCTTTCCCTCCACTAGG + Intergenic
906664793 1:47613281-47613303 GAGCTCTCATACACTGCACATGG + Intergenic
909318827 1:74256220-74256242 CAGCTCTCATACCTTGCTGATGG - Intronic
911169881 1:94759521-94759543 CAGCTGTCATACTGTAAACTGGG + Intergenic
912953551 1:114136816-114136838 CAGCTCTCCTTCTGGGCACTCGG + Intronic
918102582 1:181389319-181389341 CAGCTCTCATGCTGTACACAAGG - Intergenic
918179036 1:182070186-182070208 CAGCTCTGATTCAGTGCTCTTGG - Intergenic
918181136 1:182086704-182086726 CGGCTCTCTTCCCCTGCACTAGG - Intergenic
922620523 1:226985459-226985481 CAGCTTTCAGACCGTGCCCAAGG - Intronic
923404495 1:233646593-233646615 CTGCTCTCACTCCCTGCACTCGG - Intronic
923936078 1:238762051-238762073 CAGCTCACTTACCCTGCACCTGG - Intergenic
1065876576 10:30002168-30002190 CAGCAGTCATACTGTGCACCAGG - Intergenic
1072660291 10:97359810-97359832 CAGCTCACCTACTGTGCCCTGGG - Intronic
1079096728 11:17515846-17515868 CTGGTCTCATAACATGCACTAGG + Intronic
1079139702 11:17799889-17799911 CAGCTCTCTAACCCAGCACTTGG - Intronic
1079761842 11:24338825-24338847 GAGCTCTCATACCATGCAATGGG - Intergenic
1081934706 11:46896702-46896724 CAGCTCTGATACTGTGCTCCAGG + Intronic
1083275582 11:61595312-61595334 CAGCTCCCATCACGTGAACTGGG + Intergenic
1084576395 11:69991298-69991320 CAGCTGTCATTCAGAGCACTTGG + Intergenic
1086979470 11:93177854-93177876 CAGATCTCAAACTCTGCACTCGG + Intronic
1089475526 11:118758027-118758049 TAGCTCTCATACTGTGAACAAGG - Intronic
1098060104 12:66553009-66553031 CAGCTCTCACACCCTGTATTTGG + Intronic
1098768129 12:74515937-74515959 CACCTCTCATACCGTAAACTGGG + Intergenic
1107792826 13:44019223-44019245 CAGCTCTCATACCATAAACTGGG + Intergenic
1112520491 13:100090225-100090247 CAGCTCTCATACTGCCCACCTGG - Intronic
1118388803 14:65279711-65279733 CAGCCCTCAGGCCGTGAACTCGG + Intergenic
1119020559 14:71108614-71108636 CAGCTCTCACTCTGTGCAGTCGG + Exonic
1121213973 14:92232921-92232943 CAGATCTCAAACTCTGCACTGGG + Intergenic
1124666130 15:31594559-31594581 CAGCTCTCTAACTGTGCTCTGGG - Intronic
1127644434 15:60945756-60945778 CAGGTCTCATCATGTGCACTGGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1136068716 16:27775581-27775603 CAGATCTCAAATCTTGCACTGGG + Intronic
1142175859 16:88645003-88645025 CATCTCTCCCACCATGCACTAGG - Intronic
1158421875 18:57302067-57302089 CAGCTCCCAGAGCGTGCTCTGGG - Intergenic
1163167826 19:15509636-15509658 CAGCTCTCCCACTGGGCACTGGG - Intronic
1165435112 19:35791090-35791112 CAGCTCTCACACCGTGTAGCTGG - Intergenic
927054185 2:19354915-19354937 AAGCTCTCCAACCTTGCACTTGG - Intronic
929508165 2:42545030-42545052 CAGCTCTCATCACCTGGACTTGG - Intronic
929938169 2:46310120-46310142 CAGCTCCCACTCCATGCACTAGG - Intronic
940722232 2:157294564-157294586 CAGGTCTCAGACCCTCCACTCGG - Intronic
942351628 2:175058545-175058567 CAGCTCCCATACCCTCCTCTTGG + Intergenic
1175571704 20:60027927-60027949 GAGGTCTCATACCCTTCACTCGG + Intronic
1182334021 22:29571075-29571097 CAGCACTCTCACAGTGCACTTGG + Intronic
1182983167 22:34691685-34691707 CAGTTCTCATGCTGTGCATTAGG + Intergenic
1183588307 22:38765896-38765918 CTGCTCTCATCCAGTGCTCTAGG + Intronic
949204652 3:1423635-1423657 CAGCCATCATACCACGCACTTGG + Intergenic
956304176 3:67805725-67805747 CAGCCCTCCTACTGGGCACTGGG + Intergenic
960706358 3:120485844-120485866 CACCTATCATACAGTGCAATAGG + Intergenic
963340727 3:144029318-144029340 CAGCTCTCAGACCCTGCTGTTGG - Intronic
969386397 4:6852219-6852241 CAGCTCTCATACAGGGGCCTTGG + Intronic
969931645 4:10636667-10636689 CAGCTCTCATACCGTGCACTTGG + Intronic
972011199 4:34184354-34184376 GAGCTTTCCTACCTTGCACTAGG + Intergenic
978358192 4:107900246-107900268 CAGCTCTCATGCCGTCCACATGG - Intronic
982057984 4:151572260-151572282 CAGCTCTCTTACTGTGTGCTTGG + Intronic
985015209 4:185626761-185626783 CAGCTTTCACACAGTGCTCTAGG + Intronic
985272322 4:188206172-188206194 GAGTTCTCATACCCTGCACCTGG + Intergenic
986870769 5:12043087-12043109 CAGCTACCTTACCCTGCACTTGG + Intergenic
1002212621 5:177607841-177607863 CAGCTCTCCTTCCCTGCACTGGG + Intronic
1003181094 6:3792344-3792366 CAGCTCACCTACTGTGGACTAGG + Intergenic
1003229592 6:4240166-4240188 CAGTTCTCATGCCTTGCAGTAGG + Intergenic
1004712547 6:18186061-18186083 CAGCTCTCCTGCCTTGCTCTAGG + Intronic
1019594907 7:1853993-1854015 CCATTCTCATGCCGTGCACTGGG + Intronic
1021694585 7:23264201-23264223 GAGCTCTCACACCGTTCTCTGGG + Intronic
1023138113 7:37074458-37074480 CAGATCTCATTCCAGGCACTGGG - Intronic
1030304710 7:108006068-108006090 AAACTCTCATGCCCTGCACTCGG + Intergenic
1038388660 8:27174177-27174199 CAGCCCTCAGGCCTTGCACTGGG + Intergenic
1038460862 8:27715408-27715430 GGGCTCTGATACCTTGCACTGGG + Intergenic
1039944277 8:42116552-42116574 CAGCTCTAACACCCTGCACCTGG + Intergenic
1044502339 8:92972789-92972811 CAGTTCTCATACCGTGAAGCTGG - Intronic
1048016911 8:130505847-130505869 CAGCTCTGGTCCCTTGCACTTGG - Intergenic
1049750304 8:144279936-144279958 CAGCTCACATCCTGTGCTCTGGG - Intronic
1050057528 9:1671501-1671523 CAGCTCTCAAAACGTGCACTGGG + Intergenic
1060009002 9:120026958-120026980 TAGCTCCCATACTGTTCACTGGG + Intergenic
1061974905 9:134063124-134063146 CAGCTCTCAGACCATCCCCTTGG + Intronic
1186780298 X:12905345-12905367 CACCTCTCAAACCATGCACCAGG + Intergenic
1192548929 X:72038053-72038075 CCACTCTCATACCTTGCACCTGG - Intergenic
1198933893 X:141886817-141886839 CAGCTCTAATATCTTCCACTTGG - Intronic