ID: 969932946

View in Genome Browser
Species Human (GRCh38)
Location 4:10649840-10649862
Sequence ATTTCTTACAAATTAACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 271}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969932946 Original CRISPR ATTTCTTACAAATTAACCCA TGG (reversed) Intronic
900040277 1:456167-456189 ATTTCTTACAAATGGAGCAAGGG - Intergenic
900061706 1:691140-691162 ATTTCTTACAAATGGAGCAAGGG - Intergenic
909233062 1:73116939-73116961 ATTTCTGAAAACTAAACCCAAGG + Intergenic
909929546 1:81480012-81480034 ATTTCAGACAAATTAAGTCATGG + Intronic
910196468 1:84645594-84645616 ATTTCTTGCAAAGTACACCATGG + Exonic
911805143 1:102197258-102197280 GTTTCTTATAAATTAAACTATGG + Intergenic
916960735 1:169886009-169886031 ATTTCTTAAAAAGTCAACCATGG + Intronic
917234978 1:172882195-172882217 ATTTCTTACCATATACCCCATGG - Intergenic
918964746 1:191328679-191328701 GTTTCCTACAAATTTACACAGGG + Intergenic
919233203 1:194802853-194802875 ATTTCTTAAACATTAAACCATGG - Intergenic
919275148 1:195404418-195404440 ATTTCTTAAAAAATAAAACAAGG - Intergenic
920377339 1:205516277-205516299 AGTTCTTTGAAATTCACCCAAGG + Intronic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
923503478 1:234585634-234585656 TTTTCTCAGAAATTAACCAAAGG - Intergenic
924010399 1:239659035-239659057 ATTTATTAAAAATCAAACCAGGG - Intronic
1063064754 10:2596398-2596420 ATCTCTGACATATTAACCCTCGG - Intergenic
1063484650 10:6408277-6408299 ATTTCTTACAAATTAGTACTTGG + Intergenic
1065258813 10:23903212-23903234 ATTTCTTTAAAACTTACCCATGG + Intronic
1065337936 10:24673965-24673987 ATTTCTTAGATATAACCCCAAGG + Intronic
1065368576 10:24958649-24958671 AGGTCTTACAAATAAAGCCAAGG + Intergenic
1066320532 10:34298950-34298972 ATTTCTTACAGATCAAGGCATGG + Intronic
1067028363 10:42863703-42863725 GTTTCTGACAAATTAATCTAAGG + Intergenic
1067299764 10:44997663-44997685 CGCTCTTGCAAATTAACCCAAGG - Intergenic
1068861988 10:61856553-61856575 ATTTGTTTCTAAATAACCCAAGG - Intergenic
1069304638 10:66953785-66953807 TTTTTTTAAAAATTAGCCCAAGG + Intronic
1070484259 10:76914463-76914485 AGTTATTACACATTAGCCCAGGG + Intronic
1071119266 10:82259131-82259153 ATTTGTCTGAAATTAACCCATGG - Intronic
1071359422 10:84830982-84831004 ATTTGTTCCAAGATAACCCAGGG - Intergenic
1072382410 10:94889081-94889103 ATTTTTTAAAAACTAACCTATGG - Intergenic
1072870192 10:99110969-99110991 CTTTCATAAAAATTAACTCATGG - Intronic
1073948643 10:108782365-108782387 TTTTCTTAGAAATTAGCTCAGGG - Intergenic
1074027476 10:109651391-109651413 ACTTCATACAAATTATCTCATGG - Intergenic
1074862293 10:117519614-117519636 ATTTCACACATATTAAGCCAAGG + Intergenic
1076966497 11:92071-92093 ATTTCTTACAAATGGAGCAAGGG - Intergenic
1077595466 11:3527848-3527870 ATTTCTCTCAAATTAACTCCGGG - Intergenic
1080255499 11:30286067-30286089 ATTTCCTTCAAAATAACTCATGG + Intergenic
1080644002 11:34174912-34174934 CTTCCTTACAAATTAAGCCAGGG + Intronic
1081024947 11:37999800-37999822 ATTTCTTACATATAAACCAATGG - Intergenic
1084251363 11:67901822-67901844 ATTTCTCTCAAATTAACTCCGGG - Intergenic
1084821478 11:71694211-71694233 ATTTCTCTCAAATTAACTCCGGG + Intergenic
1085206455 11:74735985-74736007 ATTTCTGAAAATTTAACCCCTGG + Intergenic
1086534075 11:87822077-87822099 ATTACTTCCAAATTAAAACAGGG + Intergenic
1086804865 11:91227895-91227917 GTTTCTTACAAATAAACTCCAGG + Intergenic
1087548711 11:99618301-99618323 AATTCTTATAAACTAACCGAAGG + Intronic
1087552067 11:99664069-99664091 ATAACTTACAAATTAAGCCATGG - Intronic
1088295595 11:108290469-108290491 ATTTTTTAAAAAATAAGCCAGGG + Intronic
1090544154 11:127744380-127744402 ATTTCTTACAAAACTACCCATGG - Intergenic
1090585703 11:128210060-128210082 TTTTCTTACAAATAAATACAGGG - Intergenic
1091053024 11:132391898-132391920 ATTTCTAACAAATAATCACAAGG - Intergenic
1091155652 11:133369173-133369195 ATTTGTTACAAGCTAAGCCAGGG - Intronic
1091255519 11:134181468-134181490 ATCTCTTACAAATTACTACATGG - Intronic
1092614737 12:10206497-10206519 ATTTCTTACATATGAACTAAAGG - Intergenic
1092750806 12:11717712-11717734 ATTTCTTACAAAATACACCGTGG + Intronic
1093669449 12:21855772-21855794 TTTTCTTATAAATAAAGCCATGG + Intronic
1096499637 12:52056896-52056918 AAGTCTCACATATTAACCCAGGG - Intronic
1096819156 12:54220431-54220453 ATTTGTTATAAATTGACCAAGGG - Intergenic
1097946007 12:65368107-65368129 ATTTCTTTGAAATTATGCCAGGG - Intronic
1098162964 12:67664827-67664849 CTCTCTTACAAATTAACTGAGGG - Exonic
1099084581 12:78229612-78229634 ATTTCTTTCACATTGACACACGG + Intergenic
1100140487 12:91612736-91612758 ATTGCTTTGAAATTACCCCATGG + Intergenic
1103587235 12:121965070-121965092 ATTCCTTCCCAATTAAGCCATGG - Intronic
1103740036 12:123084875-123084897 ATTTATTAAAAATTAATTCAGGG - Intronic
1105410196 13:20165121-20165143 ACTTCATAGAAATTATCCCATGG - Intergenic
1106743295 13:32671282-32671304 ATTTGTGAGAAATTAAACCAGGG + Intronic
1106969706 13:35124164-35124186 TTTCCTTACAAATGAAGCCAAGG + Intronic
1110094791 13:71503773-71503795 ATTTCTTAGAAATTGACAGAAGG + Intronic
1110950511 13:81483500-81483522 ATTTCTTGTAAAATAACCAAAGG + Intergenic
1111395037 13:87655461-87655483 ATGTCTTCCAGATTCACCCATGG + Intergenic
1112850051 13:103695112-103695134 ATTTTTTAAAAAGTAACCTATGG + Intergenic
1115430005 14:33306228-33306250 ATTTCTTACTAATTAAATAATGG - Intronic
1116565116 14:46435059-46435081 ATTTCTAACAACTTAGGCCATGG + Intergenic
1117500491 14:56346396-56346418 ATTTTTTAAAAATGAACCTATGG - Intergenic
1117791509 14:59346629-59346651 AATGCTTACAAATTAAACAAAGG + Intronic
1121730575 14:96184271-96184293 AGTTCTTACAAATTAATCTCTGG - Intergenic
1122400362 14:101463432-101463454 ATTACTCACAGATTTACCCAAGG + Intergenic
1123392063 15:19886829-19886851 ATTTATTACATATTTACCAAAGG + Intergenic
1123434364 15:20244387-20244409 ATTTCTAACAAAGGATCCCAGGG + Intergenic
1123483357 15:20657044-20657066 TTTCCTTACAAATGAAGCCAAGG - Intergenic
1127718473 15:61674930-61674952 TTTTCTTATAAATCAACCTAAGG + Intergenic
1131297193 15:91159991-91160013 ATTTCTTATAATTTATCCCTTGG - Intronic
1132441629 15:101871453-101871475 ATTTCTTACAAATGGAGCAAGGG + Intergenic
1133376661 16:5292944-5292966 ATTTCTCTCAAATTAACTCCGGG + Intergenic
1136850249 16:33606708-33606730 ATTTCTAACAAAGGATCCCAGGG - Intergenic
1137295681 16:47090976-47090998 AATTGTTACAATTTCACCCATGG - Intronic
1138087849 16:54150259-54150281 ATGACTTACAAATTAATCCCAGG + Intergenic
1141373698 16:83510125-83510147 ATTTCTTACAAAATGGCCCCAGG - Intronic
1203111862 16_KI270728v1_random:1455161-1455183 ATTTCTAACAAAGGATCCCAGGG - Intergenic
1143934745 17:10471687-10471709 ATTTCTCCCAAATATACCCAGGG + Intergenic
1145965250 17:28912444-28912466 AATTATTCCAAATCAACCCAAGG + Intronic
1147854824 17:43471504-43471526 ATTTGTTTAAAATTCACCCAGGG + Intergenic
1148185288 17:45638757-45638779 ATTTCTCAGAAATTACTCCATGG - Intergenic
1150116635 17:62556659-62556681 ATTTGTTAAATATTACCCCAGGG + Intronic
1152011252 17:77719668-77719690 ATTTCTTCCAGTGTAACCCAGGG - Intergenic
1152849037 17:82620669-82620691 ATTTCCTACAAAGTAACACCGGG + Intronic
1153423284 18:4933042-4933064 ATTCCTTACAAATTTATTCAAGG - Intergenic
1154098798 18:11448420-11448442 ATTTCTTACTGATTAAGCCTTGG - Intergenic
1154099652 18:11459251-11459273 ATATCTTACTAATTTACCTAAGG + Intergenic
1156041283 18:32825812-32825834 ATTTTTTAAAAATTTACCCGTGG - Intergenic
1156395325 18:36694098-36694120 TTTTCTTTCACATTAACACAGGG + Intronic
1158777271 18:60599268-60599290 ATTTCTTAGAAATTAAAACATGG - Intergenic
1158982503 18:62777519-62777541 ATTTCTTACATATTATCTAAAGG + Intronic
1159221274 18:65466303-65466325 ATTTCCTAAAAATTAAACAAAGG + Intergenic
1159524951 18:69576460-69576482 ATTTCTGAAAAAATAAGCCAAGG + Intronic
1160308291 18:77762227-77762249 ATTTCTTATACTTTAACCCATGG - Intergenic
1160643300 19:161694-161716 ATTTCTTACAAATGGAGCAAGGG - Intergenic
1161529889 19:4781998-4782020 GTTTCTTAGAAACTAAACCATGG + Intergenic
1164055107 19:21615614-21615636 ATTTTTTACCAATGAACACAGGG - Intergenic
1164929010 19:32159300-32159322 ATTACTTACAAATCAACTTAGGG + Intergenic
1165030595 19:32995509-32995531 ATTTCTAACAAAGGATCCCAGGG + Intronic
1167536489 19:50056386-50056408 ATTTCTGACAACTAAACCTATGG + Intergenic
1168578750 19:57535692-57535714 ATTTATTACAAAAAAACCCTTGG - Intronic
925279762 2:2675292-2675314 GTTTCTTATAAATTAACTCTAGG + Intergenic
927595983 2:24397844-24397866 GTTTATTAGAAATAAACCCAAGG - Intergenic
928738733 2:34324099-34324121 ATTTCTTCCACATGAAACCATGG + Intergenic
929362283 2:41107622-41107644 ATTTATTTCTAATTAACTCATGG + Intergenic
930144834 2:47991399-47991421 ATTACTTACAAAATAAGGCAGGG + Intergenic
932956288 2:76355398-76355420 AGTTCTTCCAAATTAATCCTAGG + Intergenic
934156559 2:89206515-89206537 ATTTATTACAAATTGCCTCATGG + Intergenic
934210757 2:89976236-89976258 ATTTATTACAAATTGCCTCATGG - Intergenic
935485119 2:103643835-103643857 ATTTATTAAAATTTTACCCAAGG - Intergenic
936742021 2:115523698-115523720 ATTTGATAGAAATTAACCTATGG - Intronic
937167440 2:119834317-119834339 GTTTCTTAAAAAGTAAGCCATGG - Intronic
937801397 2:126084555-126084577 AGTTATTACAAATTGACCAAAGG - Intergenic
937871073 2:126786804-126786826 ATTTCTTATCAATTCACTCAAGG + Intergenic
937929638 2:127193964-127193986 AATTCTTAAAAAGTAACACATGG + Intronic
939096541 2:137839201-137839223 AATTCTTCCAATGTAACCCAGGG + Intergenic
939315765 2:140547607-140547629 ATTTGTTCCAAATGAAACCAGGG - Intronic
939374951 2:141352580-141352602 ATTTTTTATCAATTAACCAAAGG - Intronic
939486295 2:142815751-142815773 ATTTATTACAAAGTTACCAAAGG + Intergenic
939676060 2:145073204-145073226 ATTTCTTAAAAAAGAACCCTGGG - Intergenic
940310943 2:152278520-152278542 ATTTCTTACAATTTAAAACTTGG - Intergenic
940714591 2:157205611-157205633 ATTTCCTTCAAATTAACTCCTGG + Intergenic
940741169 2:157509707-157509729 AAATCTTACAAATTAAAACAGGG + Intergenic
941147017 2:161860603-161860625 CTTTATTTCAGATTAACCCAGGG + Intronic
942432808 2:175932507-175932529 CTTTTCTGCAAATTAACCCAGGG - Intronic
943362255 2:186933986-186934008 AATTTTTAAAAATTAACACATGG - Intergenic
943855177 2:192780755-192780777 TTTTCTAGGAAATTAACCCAGGG + Intergenic
945479778 2:210331573-210331595 ATTTCTTACTAATTAAATCTTGG + Intergenic
945701274 2:213173760-213173782 AGTTCTTACAAAGTAATCAAAGG + Intergenic
946994852 2:225379735-225379757 CTTTCTTACACAATAAACCAAGG + Intergenic
948027712 2:234791203-234791225 AATTCTAACAAGTCAACCCATGG + Intergenic
1169183811 20:3594689-3594711 ATTTCAAACTAATCAACCCAGGG - Intronic
1170143408 20:13147639-13147661 ATTTCTGAAAAATTAACCCAGGG - Intronic
1172565292 20:35925578-35925600 TCTTTTTATAAATTAACCCAAGG + Intronic
1172816540 20:37691715-37691737 GTTTCCTACAAATTTAACCATGG + Intergenic
1172921161 20:38483597-38483619 ATTTCCTAAACATTCACCCAAGG - Intronic
1177218121 21:18155402-18155424 GTTTCTTACAAATTACCCTCTGG + Intronic
1177275400 21:18906542-18906564 ATTTATTACAAGTTGACCTAGGG + Intergenic
1177419101 21:20832612-20832634 ATTTCTTCCAGAGAAACCCAGGG + Intergenic
1178084351 21:29097672-29097694 ATTTCACATAAATTAAGCCAAGG + Intronic
1178998642 21:37431871-37431893 ATTTCTTGCAAATTAACTTTAGG - Intronic
1181364299 22:22363292-22363314 ATTTCTTACTTATTTACCCCTGG - Intergenic
1181557872 22:23682486-23682508 ATTTTTAACAAATATACCCAGGG + Intergenic
1183263071 22:36808591-36808613 ATTTCTTACAAGTTAGCAGATGG - Intronic
1185076973 22:48688608-48688630 CTTACTTAGAAATGAACCCAGGG - Intronic
1185195811 22:49468932-49468954 ACATCTTACAAATAAACCTAGGG - Intronic
951001720 3:17569670-17569692 ATTTCTTAAAAAGGAACCAAGGG + Intronic
952591879 3:34965248-34965270 ATGATTTACAAATGAACCCAAGG + Intergenic
955702362 3:61694549-61694571 ACTTCTGAGAAATTATCCCATGG + Intronic
956441618 3:69286234-69286256 AAGTCTTACATATTTACCCATGG - Intronic
957010102 3:74994657-74994679 ACTTCTTCCATATTAACACAGGG + Intergenic
957065627 3:75519574-75519596 ATTTCTCTCAAATTAACTCCGGG - Intergenic
957280836 3:78149447-78149469 TTTGCTTACATATAAACCCAGGG - Intergenic
957409429 3:79818458-79818480 ATTTCTACCAAAATAAACCAGGG - Intergenic
957466729 3:80603382-80603404 GTTTGTCACAAATTAACCGAAGG + Intergenic
957958646 3:87222224-87222246 ATTTCTTACCAAATAACGCATGG - Intergenic
958842855 3:99229368-99229390 ATTTCTTACAAATTAAAATGGGG - Intergenic
959397302 3:105856476-105856498 ATGTTTTTCACATTAACCCAGGG + Intronic
959677044 3:109048139-109048161 TTTTCTTACAAATAAACTTAAGG + Intronic
959679122 3:109072573-109072595 GTTTATTCCAAATTAAGCCAGGG - Intronic
959703250 3:109317522-109317544 ACTTGTTTCAAAATAACCCATGG - Intergenic
961287702 3:125819847-125819869 ATTTCTCTCAAATTAACTCCGGG + Intergenic
961840570 3:129707365-129707387 ATTTCTAATAAATTTAACCATGG - Intronic
961899366 3:130196145-130196167 ATTTCTCTCAAATTAACTCCGGG - Intergenic
963518442 3:146336455-146336477 ATTTCTTAAAAATTAGTCCTTGG - Intergenic
965852387 3:173044259-173044281 ATTTTTTAAAAATTAATCAATGG - Intronic
965961426 3:174433009-174433031 CTTTCTTAGTAATTAAACCATGG - Intergenic
966703097 3:182877841-182877863 ATTTCTTAAATATTATCCCATGG + Intronic
967358449 3:188601341-188601363 ATTTCTTAAAATTTAGCCTATGG - Intronic
969010212 4:4055661-4055683 ATTTCTCTCAAATTAACTCCGGG - Intergenic
969932946 4:10649840-10649862 ATTTCTTACAAATTAACCCATGG - Intronic
969949097 4:10815518-10815540 ATTTTTTAAAATTTAACTCATGG - Intergenic
970453927 4:16202682-16202704 ATTTCTTAAAACTTAGCCCTGGG + Intronic
971510103 4:27414113-27414135 ATTTTTTAAAAATTAAAACAAGG + Intergenic
972923561 4:43974161-43974183 ATTTCTTATTAATTAACACATGG - Intergenic
973049630 4:45579455-45579477 TTTTCTTACAAATAAACACAAGG + Intergenic
974311505 4:60216499-60216521 ATTTCTTACAAATAAAACTTGGG - Intergenic
977836825 4:101655145-101655167 ATATGTAACAAATTACCCCAAGG + Intronic
979284208 4:118902962-118902984 ATTTTTTGGAAACTAACCCATGG + Intronic
980118123 4:128700611-128700633 ATTTCTTCCAATGTGACCCAGGG + Intergenic
980160997 4:129162732-129162754 ATTTCTTTCAAATAAACTCCTGG + Intergenic
981157241 4:141453372-141453394 ATATCTTGGAGATTAACCCATGG + Intergenic
981956593 4:150481636-150481658 ATTTCATATAAATAAAACCATGG + Intronic
982925885 4:161336425-161336447 ATTTCTTTCAAAGTAACCAGAGG + Intergenic
983718155 4:170811753-170811775 ATTTATTTCAAAATAACCAAAGG + Intergenic
984130750 4:175872694-175872716 ATTGCTTACATATTAATCCTTGG - Intronic
985169561 4:187134191-187134213 AGTTCTTACAAAATAACTGATGG - Intergenic
985968832 5:3359159-3359181 ATTTGTTAAAAATTGACCCAAGG + Intergenic
986541433 5:8848556-8848578 GCTTCTTACAAATCAACCCATGG - Intergenic
988325326 5:29757901-29757923 ATTTCTTCCAAATTGACCTATGG + Intergenic
988419940 5:30992946-30992968 ATCTCTTACAAATTAAACTGAGG + Intergenic
988787070 5:34574923-34574945 ACTTCTTAGATATTAAACCAAGG + Intergenic
989113634 5:37930619-37930641 ATTTTTTAAAAATTAGCCCTAGG - Intergenic
990483599 5:56235886-56235908 ATCTCTTCCACATTAAACCAAGG - Intergenic
990761206 5:59131558-59131580 ATTTCTTTAAATTTAACCAAGGG - Intronic
991302524 5:65143205-65143227 GTGTCTTACAAACTGACCCAAGG - Intergenic
991905369 5:71504363-71504385 ATTTCTAACAGATGAAACCAAGG + Intronic
992202720 5:74400123-74400145 ATTTTTTAAAAATTCTCCCAAGG - Intergenic
995306949 5:110663329-110663351 ATTTATTATAAATTCTCCCAAGG - Intronic
998889908 5:146735005-146735027 ATCTCTTACACATTAACCCTTGG - Intronic
1000723268 5:164735001-164735023 GTTTCTTAAAACTTAGCCCAAGG - Intergenic
1000755639 5:165155691-165155713 ATTATTTAAAAAGTAACCCAAGG - Intergenic
1001001374 5:168010384-168010406 TTCTCTTACAATTTTACCCATGG - Intronic
1002733570 5:181362778-181362800 ATTTCTTACAAATGGAGCAAGGG + Intergenic
1002750971 6:111342-111364 ATTTCTTACAAATGGAGCAAGGG - Intergenic
1003850046 6:10212496-10212518 ATTTCTGAGAATTTATCCCAAGG + Intergenic
1004058598 6:12167174-12167196 GTTTCTTACTAATTAATCCCTGG + Intergenic
1009445892 6:63741686-63741708 AGATCTAACAAATTTACCCAAGG - Intronic
1009837704 6:69025808-69025830 ATTTCATAGAAATTATCTCATGG + Intronic
1010108873 6:72201120-72201142 ATTTCTTCCAAATTAGTCCATGG + Intronic
1011378225 6:86713976-86713998 TTTTCTTTTAAAGTAACCCATGG - Intergenic
1011838505 6:91465467-91465489 ATTTCTTACCACATAATCCATGG - Intergenic
1012101419 6:95091630-95091652 ATTAATTAGAAATTAACACAAGG - Intergenic
1012341385 6:98129399-98129421 ATTTGTTACAAATAAACCAGTGG + Intergenic
1013688427 6:112612084-112612106 ATTTCCTACAAATGAAGACATGG + Intergenic
1014366199 6:120545235-120545257 ATATTTTACTAATTAAACCATGG + Intergenic
1014424198 6:121284074-121284096 ATTACATACAAATTAAAACACGG + Intronic
1014628151 6:123754973-123754995 ATTCTTCACAAATTAACCTATGG - Intergenic
1014842179 6:126233128-126233150 ATTTGGTACAAATTAAAACATGG - Intergenic
1016366678 6:143326224-143326246 ATGGCTTAAAAATCAACCCATGG + Intronic
1016383511 6:143509428-143509450 ATTTTCTACAGATAAACCCATGG - Intronic
1016514134 6:144874679-144874701 ATTTCTAACAAGTTCTCCCAGGG + Intergenic
1017221343 6:151969234-151969256 ATTTTTTAAAAATAAACCAATGG - Intronic
1017268823 6:152482315-152482337 ATTTTTGAAAAATTACCCCAAGG - Intronic
1018087214 6:160313946-160313968 GTTTCTTACAAACTATACCAGGG - Intergenic
1019237820 6:170635098-170635120 ATTTCTTACAAATGGAGCAAGGG + Intergenic
1021269290 7:18565306-18565328 ATTTTTTAAAAAATATCCCATGG + Intronic
1022408508 7:30117243-30117265 ATTTCCTAGAAGTTACCCCATGG + Intronic
1022763653 7:33385022-33385044 ATTTCTTAAAATATATCCCAAGG - Intronic
1023177746 7:37449512-37449534 ATTTCTAACCAATTAAGCCAGGG + Intergenic
1025050552 7:55730584-55730606 ATTTCTACCAATTTACCCCAAGG + Intergenic
1026001701 7:66564425-66564447 ATTTCTGACAAATACATCCATGG + Intergenic
1026254592 7:68699508-68699530 ATTTCTAACACATTCTCCCAGGG + Intergenic
1026423715 7:70268354-70268376 CTTTCTTGGAATTTAACCCATGG + Intronic
1026548855 7:71349386-71349408 ATTTCTTCTAAATTAACTAAAGG - Intronic
1028254834 7:88581494-88581516 ATTTTTTAAAAACTAACTCATGG - Intergenic
1029069322 7:97882223-97882245 ATTTCTCTCAAATTAACTCCGGG - Intergenic
1030497910 7:110322619-110322641 ACTTTTTACAAATTAATCAAGGG - Intergenic
1031100076 7:117469185-117469207 ATTGCTAACAAAATAAGCCAGGG - Intronic
1032046366 7:128612497-128612519 ATTTGTTAAATATTACCCCAGGG + Intergenic
1033115280 7:138619652-138619674 ATTTCCCACAATTTAACACAGGG - Intronic
1034312989 7:150106267-150106289 ATTTTTTAAAAATTAGCCCTTGG + Intergenic
1034793875 7:153994395-153994417 ATTTTTTAAAAATTAGCCCTTGG - Intronic
1035509951 8:171512-171534 ATTTCTTACAAATGGAGCAAGGG - Intergenic
1037791806 8:21950733-21950755 ATTTTATACAAATTAATTCAAGG - Intronic
1038970833 8:32632954-32632976 TTTCCTTATTAATTAACCCAGGG + Intronic
1041322043 8:56623518-56623540 ATTTAATAAAAATTCACCCAAGG + Intergenic
1041468018 8:58177406-58177428 ATTTCTCAGAACTTACCCCATGG + Intronic
1042169053 8:65974784-65974806 AGTTCTTAGAAATTAAAACAAGG + Intergenic
1042806273 8:72774263-72774285 TTTTCTTATAAATGAACCAAAGG + Intronic
1043274254 8:78373496-78373518 ATCACTTACAATTTAACCCCTGG - Intergenic
1044213959 8:89585193-89585215 ATTTCTTACTGGGTAACCCAGGG - Intergenic
1045696534 8:104814970-104814992 CTTTCTTACACACTTACCCAAGG - Intronic
1046460937 8:114535101-114535123 ATATCTAACTAATCAACCCAAGG + Intergenic
1046848430 8:118945136-118945158 ATTTCTTATACATGAACCAATGG + Intronic
1047881968 8:129204744-129204766 ATCTCTTACTAATTAACTAAGGG - Intergenic
1048757239 8:137753428-137753450 TTTTCTTATAAAATAAGCCAAGG + Intergenic
1048853115 8:138663147-138663169 ATTTCCTATAAATTCACCCCAGG - Intronic
1049313137 8:141944272-141944294 ATTTCTTCTAAATTAACTTATGG - Intergenic
1050073067 9:1836722-1836744 TTTTTTTACTAATTAACCCTGGG - Intergenic
1050959366 9:11707480-11707502 AGTTCTTAAAAATTCTCCCAAGG - Intergenic
1051075151 9:13224631-13224653 ATTTCATAGAAAATATCCCAAGG + Intronic
1058562755 9:106247107-106247129 GTTTCTTACTACTTAACTCAAGG - Intergenic
1059095585 9:111410140-111410162 ATTTCTGCCAATTTCACCCAGGG + Exonic
1061619512 9:131802526-131802548 ATTTCCAACACACTAACCCAGGG + Intergenic
1062758027 9:138315395-138315417 ATTTCTTACAAATGGAGCAAGGG + Intergenic
1186880614 X:13862459-13862481 ACTTCTTAAAAATCAACCCATGG + Intronic
1187031739 X:15494939-15494961 AATTCTTACAAATGAACAAAGGG + Intronic
1188130681 X:26427599-26427621 ATTTCCTAAAAATTAAACAATGG - Intergenic
1188645882 X:32566687-32566709 ATTCCTTTCAAATCAACCAAAGG - Intronic
1191911128 X:66151404-66151426 ATGTCTTACAGATTAATCCATGG + Intergenic
1192709458 X:73564401-73564423 ATTTCTTTAAAATTTATCCAGGG + Intronic
1193060242 X:77198396-77198418 ATTTCTATCAAATTACCACATGG - Intergenic
1193328750 X:80213229-80213251 ATTTCTGACATATGAGCCCAGGG - Intergenic
1193483160 X:82052794-82052816 TTTTCTTCCACATTAAACCAAGG + Intergenic
1194879482 X:99234041-99234063 ATTTCTCCCAAATTAATACATGG + Intergenic
1194974850 X:100384289-100384311 ATTTCCAATAAATTAAACCAGGG + Intronic
1195509358 X:105696628-105696650 AATTCTTACAAATTCCCTCATGG - Intronic
1196059612 X:111393425-111393447 ATTTCTTAGATATGACCCCAAGG + Intronic
1198634683 X:138683053-138683075 ATTTCTGAAAATTAAACCCAAGG + Intronic
1199133696 X:144226307-144226329 ATTATTTAAAAATTAACCTAAGG - Intergenic
1199657644 X:150012849-150012871 TTTTCTTACAAGCTAAACCATGG + Intergenic