ID: 969933554

View in Genome Browser
Species Human (GRCh38)
Location 4:10658448-10658470
Sequence TATCTCTCCTGGTTCTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969933550_969933554 15 Left 969933550 4:10658410-10658432 CCACTCCAAAACAGTAGCTTAAA 0: 1
1: 0
2: 6
3: 22
4: 222
Right 969933554 4:10658448-10658470 TATCTCTCCTGGTTCTCAGCTGG No data
969933551_969933554 10 Left 969933551 4:10658415-10658437 CCAAAACAGTAGCTTAAAACGAC 0: 1
1: 0
2: 3
3: 31
4: 153
Right 969933554 4:10658448-10658470 TATCTCTCCTGGTTCTCAGCTGG No data
969933549_969933554 24 Left 969933549 4:10658401-10658423 CCTAACACACCACTCCAAAACAG 0: 1
1: 0
2: 1
3: 29
4: 325
Right 969933554 4:10658448-10658470 TATCTCTCCTGGTTCTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969933554 Original CRISPR TATCTCTCCTGGTTCTCAGC TGG Intronic
No off target data available for this crispr