ID: 969938727

View in Genome Browser
Species Human (GRCh38)
Location 4:10708829-10708851
Sequence ACAGTGTCACAGAAGGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969938725_969938727 -5 Left 969938725 4:10708811-10708833 CCTTCATTCATAGCATTTACAGT No data
Right 969938727 4:10708829-10708851 ACAGTGTCACAGAAGGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969938727 Original CRISPR ACAGTGTCACAGAAGGAGCA CGG Intergenic
No off target data available for this crispr