ID: 969939063

View in Genome Browser
Species Human (GRCh38)
Location 4:10712294-10712316
Sequence TGGAGTATATGGATCAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969939054_969939063 10 Left 969939054 4:10712261-10712283 CCACTTAGAGAATTTTGCTTAAG No data
Right 969939063 4:10712294-10712316 TGGAGTATATGGATCAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969939063 Original CRISPR TGGAGTATATGGATCAGGGG TGG Intergenic
No off target data available for this crispr