ID: 969941203

View in Genome Browser
Species Human (GRCh38)
Location 4:10733438-10733460
Sequence CCATGTTATACTTGGTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969941199_969941203 17 Left 969941199 4:10733398-10733420 CCTTTGGAGACAGTCAAGTTCCT No data
Right 969941203 4:10733438-10733460 CCATGTTATACTTGGTAAGCTGG No data
969941200_969941203 -3 Left 969941200 4:10733418-10733440 CCTGCTTCATTATGTATTAACCA No data
Right 969941203 4:10733438-10733460 CCATGTTATACTTGGTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969941203 Original CRISPR CCATGTTATACTTGGTAAGC TGG Intergenic
No off target data available for this crispr