ID: 969950543

View in Genome Browser
Species Human (GRCh38)
Location 4:10831057-10831079
Sequence TTAGAATTCCACATTTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969950543_969950545 -7 Left 969950543 4:10831057-10831079 CCCAGATAAATGTGGAATTCTAA No data
Right 969950545 4:10831073-10831095 ATTCTAATATAAAACAGAATTGG No data
969950543_969950546 15 Left 969950543 4:10831057-10831079 CCCAGATAAATGTGGAATTCTAA No data
Right 969950546 4:10831095-10831117 GTCCAGCACTTCCTGATCCTTGG No data
969950543_969950551 29 Left 969950543 4:10831057-10831079 CCCAGATAAATGTGGAATTCTAA No data
Right 969950551 4:10831109-10831131 GATCCTTGGGAATAACAGAAGGG No data
969950543_969950550 28 Left 969950543 4:10831057-10831079 CCCAGATAAATGTGGAATTCTAA No data
Right 969950550 4:10831108-10831130 TGATCCTTGGGAATAACAGAAGG No data
969950543_969950547 16 Left 969950543 4:10831057-10831079 CCCAGATAAATGTGGAATTCTAA No data
Right 969950547 4:10831096-10831118 TCCAGCACTTCCTGATCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969950543 Original CRISPR TTAGAATTCCACATTTATCT GGG (reversed) Intergenic
No off target data available for this crispr