ID: 969956328

View in Genome Browser
Species Human (GRCh38)
Location 4:10895000-10895022
Sequence AGGGAGATGGAGAATAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969956322_969956328 28 Left 969956322 4:10894949-10894971 CCATCACAGGGTTTATTAATACA No data
Right 969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969956328 Original CRISPR AGGGAGATGGAGAATAAGGA AGG Intergenic
No off target data available for this crispr