ID: 969961508

View in Genome Browser
Species Human (GRCh38)
Location 4:10948999-10949021
Sequence TAGGCCCACCTAAATTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969961508_969961511 14 Left 969961508 4:10948999-10949021 CCTCAATAATTTAGGTGGGCCTA No data
Right 969961511 4:10949036-10949058 GGTGTTAAGAGCAGAAACTGAGG No data
969961508_969961512 25 Left 969961508 4:10948999-10949021 CCTCAATAATTTAGGTGGGCCTA No data
Right 969961512 4:10949047-10949069 CAGAAACTGAGGTTTCCTTGAGG No data
969961508_969961509 -7 Left 969961508 4:10948999-10949021 CCTCAATAATTTAGGTGGGCCTA No data
Right 969961509 4:10949015-10949037 GGGCCTAATGAGTCAGTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969961508 Original CRISPR TAGGCCCACCTAAATTATTG AGG (reversed) Intergenic
No off target data available for this crispr