ID: 969964674

View in Genome Browser
Species Human (GRCh38)
Location 4:10982062-10982084
Sequence TTGAATAAATAGATGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969964674_969964675 30 Left 969964674 4:10982062-10982084 CCTTTGTTCATCTATTTATTCAA No data
Right 969964675 4:10982115-10982137 TTTAAAATCTACAGCCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969964674 Original CRISPR TTGAATAAATAGATGAACAA AGG (reversed) Intergenic
No off target data available for this crispr