ID: 969981928

View in Genome Browser
Species Human (GRCh38)
Location 4:11166512-11166534
Sequence CTCCCATTAAAGATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969981928_969981939 11 Left 969981928 4:11166512-11166534 CCCTGCCCCATCTTTAATGGGAG No data
Right 969981939 4:11166546-11166568 AGGAACATGTGTGAAATCCTTGG No data
969981928_969981940 12 Left 969981928 4:11166512-11166534 CCCTGCCCCATCTTTAATGGGAG No data
Right 969981940 4:11166547-11166569 GGAACATGTGTGAAATCCTTGGG No data
969981928_969981936 -9 Left 969981928 4:11166512-11166534 CCCTGCCCCATCTTTAATGGGAG No data
Right 969981936 4:11166526-11166548 TAATGGGAGGGAGGTTCCCAAGG No data
969981928_969981941 20 Left 969981928 4:11166512-11166534 CCCTGCCCCATCTTTAATGGGAG No data
Right 969981941 4:11166555-11166577 TGTGAAATCCTTGGGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969981928 Original CRISPR CTCCCATTAAAGATGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr