ID: 969990183

View in Genome Browser
Species Human (GRCh38)
Location 4:11254032-11254054
Sequence GGATCACTTCTAGTGAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969990183_969990191 14 Left 969990183 4:11254032-11254054 CCTTGCCTCACTAGAAGTGATCC No data
Right 969990191 4:11254069-11254091 CACACCAGATGTCCAGCAGAGGG No data
969990183_969990193 23 Left 969990183 4:11254032-11254054 CCTTGCCTCACTAGAAGTGATCC No data
Right 969990193 4:11254078-11254100 TGTCCAGCAGAGGGTAAAGCTGG No data
969990183_969990190 13 Left 969990183 4:11254032-11254054 CCTTGCCTCACTAGAAGTGATCC No data
Right 969990190 4:11254068-11254090 CCACACCAGATGTCCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969990183 Original CRISPR GGATCACTTCTAGTGAGGCA AGG (reversed) Intergenic
No off target data available for this crispr