ID: 969992121

View in Genome Browser
Species Human (GRCh38)
Location 4:11275449-11275471
Sequence GGGTGCAGAAAATTTATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969992121_969992125 21 Left 969992121 4:11275449-11275471 CCCAGGATAAATTTTCTGCACCC No data
Right 969992125 4:11275493-11275515 GCTCACTGCTTTTTAGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969992121 Original CRISPR GGGTGCAGAAAATTTATCCT GGG (reversed) Intergenic
No off target data available for this crispr