ID: 969997096

View in Genome Browser
Species Human (GRCh38)
Location 4:11324307-11324329
Sequence ACTAGGCAGTGCCCCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969997096_969997100 -8 Left 969997096 4:11324307-11324329 CCCCCACTGGGGCACTGCCTAGT No data
Right 969997100 4:11324322-11324344 TGCCTAGTAGATCTGTAAGAAGG No data
969997096_969997106 24 Left 969997096 4:11324307-11324329 CCCCCACTGGGGCACTGCCTAGT No data
Right 969997106 4:11324354-11324376 TCCTCCAGACCCCAGAATGGTGG No data
969997096_969997105 21 Left 969997096 4:11324307-11324329 CCCCCACTGGGGCACTGCCTAGT No data
Right 969997105 4:11324351-11324373 CCATCCTCCAGACCCCAGAATGG No data
969997096_969997101 -7 Left 969997096 4:11324307-11324329 CCCCCACTGGGGCACTGCCTAGT No data
Right 969997101 4:11324323-11324345 GCCTAGTAGATCTGTAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969997096 Original CRISPR ACTAGGCAGTGCCCCAGTGG GGG (reversed) Intergenic