ID: 969997509

View in Genome Browser
Species Human (GRCh38)
Location 4:11328067-11328089
Sequence TAAAGTTATCACTTTGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969997509_969997513 -5 Left 969997509 4:11328067-11328089 CCTGGTCCAAAGTGATAACTTTA No data
Right 969997513 4:11328085-11328107 CTTTATGGCTGGCCATCCTCTGG No data
969997509_969997514 -4 Left 969997509 4:11328067-11328089 CCTGGTCCAAAGTGATAACTTTA No data
Right 969997514 4:11328086-11328108 TTTATGGCTGGCCATCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969997509 Original CRISPR TAAAGTTATCACTTTGGACC AGG (reversed) Intergenic
No off target data available for this crispr