ID: 969997514

View in Genome Browser
Species Human (GRCh38)
Location 4:11328086-11328108
Sequence TTTATGGCTGGCCATCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969997511_969997514 -10 Left 969997511 4:11328073-11328095 CCAAAGTGATAACTTTATGGCTG No data
Right 969997514 4:11328086-11328108 TTTATGGCTGGCCATCCTCTGGG No data
969997509_969997514 -4 Left 969997509 4:11328067-11328089 CCTGGTCCAAAGTGATAACTTTA No data
Right 969997514 4:11328086-11328108 TTTATGGCTGGCCATCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969997514 Original CRISPR TTTATGGCTGGCCATCCTCT GGG Intergenic
No off target data available for this crispr